专利摘要:
The invention relates to a chimeric monomer-dimer hybrid protein wherein said protein comprises a first and a second polypeptide chain, said first polypeptide chain comprising at least a portion of an immunoglobulin constant region and a biologically active molecule, and said second polypeptide chain comprising at least a portion of an immunoglobulin constant region without the biologically active molecule of the first chain. The invention also relates to methods of using and methods of making the chimeric monomer-dimer hybrid protein of the invention.
公开号:AU2013204787A1
申请号:U2013204787
申请日:2013-04-12
公开日:2013-05-09
发明作者:Alan J. Bitonti;Susan C. Low;Adam R. Mezo;Robert T. Peters;Daniel S. Rivera;James M. Stattel
申请人:Bioverativ Therapeutics Inc;
IPC主号:C07H21-04
专利说明:
Australian Patents Act 1990 - Regulation 3.2A Original Complete Specification, Standard Patent Invention Title: Immunoglobulin Chimeric Monomer-Dimer Hybrids The following statement is a full description of this invention, including the best method of performing it known to the applicant: CROSS-REFERENCE TO RELATED APPLICATIONS [001] This application is a divisional application of U.S. application Ser. No. 11/588,431, filed Oct. 27, 2006, which is a continuation application of U.S. application Ser. No. 10/841,250, filed May 6, 2004 and issued Jul. 29, 2008 as U.S. Pat. No. 7,404,956, which claims priority to U.S. Provisional AppIn. No. 60/469,600 filed May 6, 2003, U.S. Provisional Appln. No. 60/487,964 filed Jul. 17, 2003, and U.S. Provisional Appln. No. 60/539,207 filed Jan. 26, 2004, all of which are incorporated by reference in their entirety. The U.S. non-provisional application entitled Methods for Chemically Synthesizing Immunoglobulin Chimeric Proteins, filed concurrently on May 6, 2004, is incorporated by reference. FIELD OF THE INVENTION [002] The invention relates generally to therapeutic chimeric proteins, comprised of two polypeptide chains, wherein the first chain is comprised of a therapeutic biologically active molecule and the second chain is not comprised of the therapeutic biologically active molecule of the first chain. More specifically, the invention relates to chimeric proteins, comprised of two polypeptide chains, wherein both chains are comprised of at least a portion of an immunoglobulin constant region wherein the first chain is modified to further comprise a biologically active molecule, and the second chain is not so modified. The invention, thus relates to a chimeric protein that is a monomer-dimer hybrid, i.e., a chimeric protein having a dimeric aspect and a monomeric aspect, wherein the dimeric aspect relates to the fact that it is comprised of two polypeptide chains each comprised of a portion of an immunoglobulin constant region, and wherein the monomeric aspect relates to the fact that only one of the two chains is comprised of a therapeutic biologically active molecule. FIG. 1 illustrates one example of a monomer-dimer hybrid wherein the biologically active molecule is erythropoietin (EPO) and the portion of an 2 immunoglobulin constant region is an IgG Fc region. BACKGROUND OF THE INVENTION [0031 Immunoglobulins are comprised of four polypeptide chains, two heavy chains and two light chains, which associate via disulfide bonds to form tetramers. Each chain is further comprised of one variable region and one constant region. The variable regions mediate antigen recognition and binding, while the constant regions, particularly the heavy chain constant regions, mediate a variety of effector functions, e.g., complement binding and Fc receptor binding (see, e.g., U.S. Patent Nos.: 6,086,875; 5,624,821; 5,116,964). [004] The constant region is further comprised of domains denoted CH (constant heavy) domains (CHI, CH2, etc.). Depending on the isotype, (i.e. IgG, igM, IgA IgD, IgE) the constant region can be comprised of three or four CH domains. Some isotypes (e.g. IgG) constant regions also contain a hinge region Janeway et al. 2001, Immunobiology, Garland Publishing, N.Y., N.Y. [005] The creation of chimeric proteins comprised of immunoglobulin constant regions linked to a protein of interest, or fragment thereof, has been described (see, e.g., U.S. Patent Nos. 5,480,981 and 5,808,029; Gascoigne et-al. 1987, Proc. Nat!. A cad. Sci. USA 84:2936; Capon et al. 1989, Nature 337:525; Traunecker et al. 1989, Nature 339:68; Zettmeissl et al. 1990, DNA Cell Biol. USA 9:347; Byrn et al. 1990, Nature 344:667; Watson et al. 1990, J. Cell. Biol. 110:2221; Watson et al. 1991, Nature 349:164; Aruffo et al. 1990, Cell 61:1303; Linsley et al. 1991, J. Exp. Med. 173:721; Linsley et al. 1991, J. Exp. Med. 174:561; Stamenkovic et al., 1991, Cell 66:1133; Ashkenazi et al. 1991, Proc. Nat/. Acad. Sci. USA 3 Exp. Med. 174:1483; Bennett et al. 1991, J. Biol. Chem. 266:23060; Kurschner et al. 1992, J. Biol. Chem. 267:9354; Chalupny et al. 1992, Proc. Nati. Acad. Sci. USA 89:10360; Ridgway and Gorman, 1991, J. Cell. Biol. 115, Abstract No. 1448; Zheng et al. 1995, J. Immun. 154:5590). These molecules usually possess both the biological activity associated with the linked molecule of interest as well as the effector function, or some other desired characteristic associated with the immunoglobulin constant region (e.g. biological stability, cellular secretion). [006] The Fc portion of an immunoglobulin constant region, depending on the immunoglobulin isotype can include the CH2, CH3, and CH4 domains, as well as the hinge region. Chimeric proteins comprising an Fc portion of an immunoglobulin bestow several desirable properties on a chimeric protein including increased stability, increased serum half life (see Capon et al. 1989, Nature 337:525) as well as binding to Fc receptors such as the neonatal Fc receptor (FcRn) (U.S. Patent Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1). [007] FcRn is active in adult epithelial tissue and expressed in the lumen of the intestines, pulmonary airways, nasal surfaces, vaginal surfaces, colon and rectal surfaces (U.S. Patent No. 6,485,726). Chimeric proteins comprised of FcRn binding partners (e.g. IgG, Fc fragments) can be effectively shuttled across epithelial barriers by FcRn, thus providing a non-invasive means to systemically administer a desired therapeutic molecule. Additionally, chimeric proteins comprising an FcRn binding partner are endocytosed by cells expressing the FcRn. But instead of being marked for degradation, these chimeric proteins are recycled out into circulation again, thus increasing the in vivo half life of these proteins. 4 [008] Portions of immunoglobulin constant regions, e.g., FcRn binding partners typically associate, via disulfide bonds and other non-specific interactions, with one another to form dimers and higher order multimers. The instant invention is based in part upon the surprising discovery that transcytosis of chimeric proteins comprised of FcRn binding partners appears to be limited by the molecular weight of the chimeric protein, with higher molecular weight species being transported less efficiently. [009] Chimeric proteins comprised of biologically active molecules, once administered, typically will interact with a target molecule or cell. The instant invention is further based in part upon the surprising discovery that monomer-dimer hybrids, with one biologically active molecule, but two portions of an immunoglobulin constant region, e.g., two FcRn binding partners, function and can be transported more effectively than homodimers, also referred to herein simply as "dimers" or higher order multimers with two or more copies of the biologically active molecule. This is due in part to the fact that chimeric proteins, comprised of two or more biologically active molecules, which exist as dimers and higher order multimers, can be sterically hindered from interacting with their target molecule or cell, due to the presence of the two or more biologically active molecules in close proximity to one another and that the biologically active molecule can have a high affinity for itself. [010] Accordingly one aspect of the invention provides chimeric proteins comprised of a biologically active molecule that is transported across the epithelium barrier. An additional aspect of the invention provides chimeric proteins comprised of at least one biologically active molecule that is able to interact with its target molecule or cell with little or no steric hindrance or self aggregation. 5 [011] The aspects of the invention provide for chimeric proteins comprising a first and second polypeptide chain, the first chain comprising at least a portion of immunoglobulin constant region, wherein the portion of an immunoglobulin constant region has been modified to include a biologically active molecule and the second chain comprising at least a portion of immunoglobulin constant region, wherein the portion of an immunoglobulin constant region has not been so modified to include the biologically active molecule of the first chain. SUMMARY OF THE INVENTION [012] The invention relates to a chimeric protein comprising one biologically active molecule and two molecules of at least a portion of an immunoglobulin constant region. The chimeric protein is capable of interacting with a target molecule or cell with less steric hindrance compared to a chimeric protein comprised of at least two biologically active molecules and at least a portion of two immunoglobulin constant regions. The invention also relates to a chimeric protein comprising at least one biologically active molecule and two molecules of at least a portion of an immunoglobulin constant region that is transported across an epithelium barrier more efficiently than a corresponding homodimer, i.e., wherein both chains are linked to the same biologically active molecule. The invention, thus relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region, but no immunoglobulin variable region and without any biologically active molecule attached. 6 [013] The invention relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without an immunoglobulin variable region or any biologically active molecule and wherein said second chain is not covalently bonded to any molecule having a molecular weight greater than 1 kD, 2 kD, 5 kD, 10 kD, or 20 kD. In one embodiment, the second chain is not covalently bonded to any molecule having a molecular weight greater than 0-2 kD. In one embodiment, the second chain is not covalently bonded to any molecule having a molecular weight greater than 5-10 kD. In one embodiment, the second chain is not covalently bonded to any molecule having a molecular weight greater than 15-20 kD. [014] The invention relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region not covalently linked to any other molecule except the portion of an immunoglobulin of said first polypeptide chain. [015] The invention relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain consists of at least a portion of an immunoglobulin constant region and optionally an affinity tag. 7 [016] The invention relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain consists essentially of at least a portion of an immunoglobulin constant region and optionally an affinity tag. [017] The invention relates to a chimeric protein comprising a first and a second polypeptide chain linked together, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without an immunoglobulin variable region or any biologically active molecule and optionally a molecule with a molecular weight less than 10 kD, 5 kD, 2 kD or 1 kD. In one embodiment, the second chain comprises a molecule less than 15-20 kD. In one embodiment, the second chain comprises a molecule less than 5-10 kD. In one embodiment, the second chain comprises a molecule less than 1-2 kD. [018] The invention relates to a chimeric protein comprising a first and second polypeptide chain, wherein said first chain comprises a biologically active molecule, at least a portion of an immunoglobulin constant region, and at least a first domain, said first domain having at least one specific binding partner, and wherein said second chain comprises at least a portion of an immunoglobulin constant region, and at least a second domain, wherein said second domain is a specific binding partner of said first domain, without any immunoglobulin variable region or a biologically active molecule. 8 [019] The invention relates to a method of making a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are not the same, said method comprising transfecting a cell with a first DNA construct comprising a DNA molecule encoding a first polypeptide chain comprising a biologically active molecule and at least a portion of an immunoglobulin constant region and optionally a linker, and a second DNA construct comprising a DNA molecule encoding a second polypeptide chain comprising at least a portion of an immunoglobulin constant region without any biologically active molecule or an immunoglobulin variable region, and optionally a linker, culturing the cells under conditions such that the polypeptide chain encoded by the first DNA construct is expressed and the polypeptide chain encoded by the second DNA construct is expressed and isolating monomer-dimer hybrids comprised of the polypeptide chain encoded by the first DNA construct and the polypeptide chain encoded by the second DNA construct. [020] The invention relates to a method of making a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are not the same, and wherein said first polypeptide chain comprises a biologically active molecule, at least a portion of an immunoglobulin constant region, and at least a first domain, said first domain, having at least one specific binding partner, and wherein said second polypeptide chain comprises at least a portion of an immunoglobulin constant region and a second domain, wherein said second domain, is a specific binding partner of said first domain, without any biologically active molecule or an immunoglobulin variable region, said method comprising transfecting a cell with a first DNA construct 9 comprising a DNA molecule encoding said first polypeptide chain and a second DNA construct comprising a DNA molecule encoding, said second polypeptide chain, culturing the cells under conditions such that the polypeptide chain encoded by the first DNA construct is expressed and the polypeptide chain encoded by the second DNA construct is expressed and isolating monomer-dimer hybrids comprised of the polypeptide chain encoded by the first DNA construct and polypeptide chain encoded by the second DNA construct. [021] The invention relates to a method of making a chimeric protein of the invention said method comprising transfecting a cell with a first DNA construct comprising a DNA molecule encoding a first polypeptide chain comprising a biologically active molecule and at least a portion of an immunoglobulin constant region and optionally a linker, culturing the cell under conditions such that the polypeptide chain encoded by the first DNA construct is expressed, isolating the polypeptide chain encoded by the first DNA construct and transfecting a cell with a second DNA construct comprising a DNA molecule encoding a second polypeptide chain comprising at least a portion of an immunoglobulin constant region without any biologically active molecule or immunoglobulin variable region, culturing the cell under conditions such that the polypeptide chain encoded by the second DNA construct is expressed, isolating the polypeptide chain, encoded by the second DNA construct, combining the polypeptide chain, encoded by the first DNA construct and the polypeptide chain encoded by the second DNA construct under conditions such that monomer-dimer hybrids comprising the polypeptide chain encoded by the first DNA construct and the polypeptide chain encoded by the second DNA construct form, and isolating said monomer-dimer hybrids. 10 [022] The invention relates to a method of making a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are not the same, said method comprising transfecting a cell with a DNA construct comprising a DNA molecule encoding a polypeptide chain comprising at least a portion of an immunoglobulin constant region, culturing the cells under conditions such that the polypeptide chain encoded by the DNA construct is expressed with an N terminal cysteine such that dimers of the polypeptide chain form and isolating dimers comprised of two copies of the polypeptide chain encoded by the DNA construct and chemically reacting the isolated dimers with a biologically active molecule, wherein said biologically active molecule has a C terminus thioester, under conditions such that the biologically active molecule reacts predominantly with only one polypeptide chain of the dimer thereby forming a monomer-dimer hybrid. [023] The invention relates to a method of making a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are not the same, said method comprising transfecting a cell with a DNA construct comprising a DNA molecule encoding a polypeptide chain comprising at least a portion of an immunoglobulin constant region, culturing the cells under conditions such that the polypeptide chain encoded by the DNA construct is expressed with an N terminal cysteine such that dimers of the polypeptide chains form, and isolating dimers comprised of two copies of the polypeptide chain encoded by the DNA construct, and chemically reacting the isolated dimers with a biologically active molecule, wherein said biologically active molecule has a C terminus thioester, such that the biologically active molecule is 11 linked to each chain of the dimer, denaturing the dimer comprised of the portion of the immunoglobulin linked to the biologically active molecule such that monomeric chains form, combining the monomeric chains with a polypeptide chain comprising at least a portion of an immunoglobulin constant region without a biologically active molecule linked to it, such that monomer-dimer hybrids form, and isolating the monomer-dimer hybrids. [024] The invention relates to a method of making a chimeric protein comprising a first and second polypeptide chain, wherein the first polypeptide chain and the second polypeptide chain are not the same, said method comprising transfecting a cell with a DNA construct comprising a DNA molecule encoding a polypeptide chain comprising at least a portion of an immunoglobulin constant region, culturing the cells under conditions such that the polypeptide chain encoded by the DNA construct is expressed as a mixture of two polypeptide chains, wherein the mixture comprises a polypeptide with an N terminal cysteine, and a polypeptide with a cysteine in close proximity to the N terminus, isolating timers comprised of the mixture of polypeptide chains encoded by the DNA construct and chemically reacting the isolated dimers with a biologically active molecule, wherein said biologically active molecule has an active thioester, such that at least some monomer-dimer hybrid forms and isolating the monomer-dimer hybrid from said mixture. [025] The invention relates to a method of treating a disease or condition comprising administering a chimeric protein of the invention thereby treating the disease or condition. 12 [026] Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. [027] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. 13 BRIEF DESCRIPTION OF THE DRAWINGS [028] Figure 1 is a schematic diagram comparing the structure of an EPO-Fc homodimer, or dimer, and the structure of an Epo-FC monomer-dimer hybrid. [029] Figure 2a is the amino acid sequence of the chimeric protein Factor ViI-Fc (SEQ ID NO: 6). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell and the propeptide (bold), which is recognized by the vitamin K-dependent y carboxylase which modifies the Factor VII to achieve full activity. The sequence is subsequently cleaved by PACE to yield Factor VII-Fc. [030] Figure 2b is the amino acid sequence of the chimeric protein Factor IX Fc (SEQ ID NO: 8). Included in the sequence is the signal peptide (underlined) which is cleaved by the cell and the propeptide (bold) which is recognized by the vitamin K-dependent y carboxylase which modifies the Factor IX to achieve full activity. The sequence is subsequently cleaved by PACE to yield Factor IX-Fc. [031] Figure 2c is the amino acid sequence of the chimeric protein IFNa-Fc (SEQ ID NO: 10). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature IFNa-Fc. [032] Figure 2d is the amino acid sequence of the chimeric protein IFNa-Fc A linker (SEQ ID NO: 12). Included in the sequence is the signal peptide (underlined) which is cleaved by the cell resulting in the mature IFNa- Fc A linker. [033] Figure 2e is the amino acid sequence of the chimeric protein Flag-Fc (SEQ ID NO: 14). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature Flag-Fc. [034] Figure 2f is the amino acid sequence of the chimeric protein Epo-CCA Fc (SEQ ID NO: 16). Included in the sequence is the signal peptide (underlined), 14 which is cleaved by the cell resulting in the mature Epo-CCA-Fc. Also shown in bold is the acidic coiled coil domain. [0351 Figure 2g is the amino acid sequence of the chimeric protein CCB-Fc (SEQ ID NO: 18). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature CCB-Fc. Also shown in bold is the basic coiled coil domain. [0361 Figure 2h is the amino acid sequence of the chimeric protein Cys-Fc (SEQ ID NO: 20). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature Cys-Fc. When this sequence is produced in CHO cells a percentage of the molecules are incorrectly cleaved by the signal peptidase such that two extra amino acids are left on the N terminus, thus preventing the linkage of a biologically active molecule with a C terminal thioester (e.g., via native ligation). When these improperly cleaved species dimerize with the properly cleaved Cys-Fc and are subsequently reacted with biologically active molecules with C terminal thioesters, monomer-dimer hybrids form. [037] Figure 2i is the amino acid sequence of the chimeric protein IFNa GS15-Fc (SEQ ID NO: 22). Included in the sequence is the signal peptide (underlined) which is cleaved by the cell resulting in the mature IFNa- GS15-Fc. [038] Figure 2j is the amino acid sequence of the chimeric protein Epo-Fc (SEQ ID NO: 24). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell resulting in the mature Epo-Fc. Also shown in bold is the 8 amino acid linker. [039] Figure 3a is the nucleic acid sequence of the chimeric protein Factor VII-Fc (SEQ ID NO: 7). Included in the sequence is the signal peptide (underlined) 15 and the propeptide (bold) which is recognized by the vitamin K-dependent y carboxylase which modifies the Factor VII to achieve full activity. The translated sequence is subsequently cleaved by PACE to yield mature Factor VII-Fc. [040] Figure 3b is the nucleic acid sequence of the chimeric protein Factor IX-Fc (SEQ ID NO: 9). Included in the sequence is the signal peptide (underlined) and the propeptide (bold) which is recognized by the vitamin K-dependent y carboxylase which modifies the Factor IX to achieve full activity. The translated sequence is subsequently cleaved by PACE to yield mature Factor IX-Fc. [041] Figure 3c is the nucleic acid sequence of the chimeric protein IFNa-Fc (SEQ ID NO: 11). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature IFNa-Fc. [042] Figure 3d is the nucleic acid sequence of the chimeric protein IFNa-Fc A linker (SEQ ID NO: 13). Included in the sequence is the signal peptide (underlined) which is cleaved by the cell after translation resulting in the mature IFNa- Fc A linker. [043] Figure 3e is-the amino acid sequence of the chimeric protein Flag-Fc (SEQ ID NO: 15). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature Flag-Fc. [044] Figure 3f is the nucleic acid sequence of the chimeric protein Epo CCA-Fc (SEQ ID NO: 17). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature Epo-CCA-Fc. Also shown in bold is the acidic coiled coil domain. [045] Figure 3g is the nucleic acid sequence of the chimeric protein CCB-Fc (SEQ ID NO: 19). Included in the sequence is the signal peptide (underlined), which 16 is cleaved by the cell after translation resulting in the mature CCB-Fc. Also shown in bold is the basic coiled coil domain. [046] Figure 3h is the nucleic acid sequence of the chimeric protein Cys-Fc (SEQ ID NO: 21). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature Cys-Fc. [047] Figure 3i is the nucleic acid sequence of the chimeric protein IFNa GS15-Fc (SEQ ID NO: 23). Included in the sequence is the signal peptide (underlined) which is cleaved by the cell after translation resulting in the mature IFNa-GS15-Fc. [048] Figure 3j is the nucleic acid sequence of the chimeric protein Epo-Fc (SEQ ID NO: 25). Included in the sequence is the signal peptide (underlined), which is cleaved by the cell after translation resulting in the mature Epo-Fc. Also shown in bold is a nucleic acid sequence encoding the 8 amino acid linker. [049] Figure 4 demonstrates Ways to form monomer-dimer hybrids through native ligation. SVGCPPC, VGCPPC, STGCPPC and CPPC disclosed as SEQ ID NOS 87-90, respectively. [050] Figure 5a shows the amino acid sequence of Fc MESNA (SEQ ID NO:4). [051] Figure 5b shows the DNA sequence of Fc MESNA (SEQ ID NO:5). [0521 Figure 6 compares antiviral activity of IFNa homo-dimer (i.e. comprised of 2 IFNa molecules) with an IFNa monomer-dimer hybrid (i.e. comprised of 1 IFNa molecule). 17 [053] Figure 7 is a comparison of clotting activity of a chimeric monomer dimer hybrid Factor Vila-Fc (one Factor VI1 molecule) and a chimeric homodimer Factor Vila-Fc (two Factor VI molecules). [054] Figure 8 compares oral dosing in neonatal rats of a chimeric monomer dimer hybrid Factor Vlla-Fc (one Factor VII molecule) and a chimeric homodimer Factor Vila-Fc (two Factor VII molecules). [055] Figure 9 compares oral dosing in neonatal rats of a. chimeric monomer dimer hybrid Factor IX-Fc (one Factor IX molecule) with a chimeric homodimer. [056] Figure 10 is a time course study comparing a chimeric monomer-dimer hybrid Factor IX-Fc (one Factor IX molecule) administered orally to neonatal rats with an orally administered chimeric homodimer. [0571 Figure 11 demonstrates pharmokinetics of Epo-Fc dimer compared to Epo-Fc monomer-dimer hybrid in cynomolgus monkeys after a single pulmonary dose. [058] Figure 12 compares serum concentration in monkeys of subcutaneously administered Epo-Fc monomer-dimer hybrid with subcutaneously administered Aranesp* (darbepoetin alfa). [059] Figure 13 compares serum concentration in monkeys of intravenously administered Epo-Fc monomer-dimer hybrid with intravenously administered Aranesp* (darbepoetin alfa) and Epogen* (epoetin alfa). [060] Figure 14 shows a trace from a Mimetic Red 2TIA column (ProMetic LifeSciences, Inc., Wayne, NJ) and an SDS-PAGE of fractions from the column containing EpoFc monomer-dimer hybrid, EpoFc dimer, and Fc. EpoFc monomer 18 dimer hybrid is found in fractions 11, 12, 13, and 14. EpoFc dimer is found in fraction 18. Fc is found in fractions 112. [0611 Figure 15 shows the pharmacokinetics of IFNPFc with an 8 amino acid linker in cynomolgus monkeys after a single pulmonary dose. [062] Figure 16 shows neopterin stimulation in response to the IFNP-Fc homodimer and the IFNP-Fc N297A monomer-dimer hybrid in cynomolgus monkeys. [063] Figure 17a shows the nucleotide sequence of interferon p-Fc (SEQ ID NO: 98); Figure 17b shows the amino acid sequence of interferon @-Fc (SEQ ID NO: 99). [064] Figure 18 shows the amino acid sequence of T20(a; SEQ ID NO: 1); T21(b; SEQ ID NO: 2) and T1249(c; SEQ ID NO: 3). DESCRIPTION OF THE EMBODIMENTS A. Definitions [0651 Affinity tag, as used herein, means a molecule attached to a second molecule of interest, capable of interacting with a specific binding partner for the purpose of isolating or identifying said second molecule of interest. (066] Analogs of chimeric proteins of the invention, or proteins or peptides substantially identical to the chimeric proteins of the invention, as used herein, means that a relevant amino acid sequence of a protein or a peptide is at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to a given sequence. By way of example, such sequences may be variants derived from various species, or they may be derived from the given sequence by truncation, deletion, amino acid substitution or addition. Percent identity between two amino acid sequences is determined by standard alignment algorithms such as, for 19 example, Basic Local Alignment Tool (BLAST) described in Altschul et al. 1990, J. Mol. Biol., 215:403-410, the algorithm of Needleman et al. 1970, J. Mol. Biol., 48:444-453; the algorithm of Meyers et al. 1988, Comput. Apple. Biosci., 4:11-17; or Tatusova et al. 1999, FEMS Microbiol. Lett., 174:247-250, etc. Such algorithms are incorporated into the BLASTN, BLASTP and "BLAST 2 Sequences" programs (see www.ncbi.nlm.nih.gov/BLAST). When utilizing such programs, the default parameters can be used. For example, for nucleotide sequences the following settings can be used for "BLAST 2 Sequences": program BLASTN, reward for match 2, penalty for mismatch -2, open gap and extension gap penalties 5 and 2 respectively, gap xdropoff 50, expect 10, word size 11, filter ON. For amino acid sequences the following settings can be used for "BLAST 2 Sequences": program BLASTP, matrix BLOSUM62, open gap and extension gap penalties 11 and 1 respectively, gap xdropoff 50, expect 10, word size 3, filter ON. [067] Bioavailability, as used herein, means the extent and rate at which a substance is absorbed into a living system or is made available at the site of physiological activity. [0681 Biologically active molecule, as used herein, means a non immunoglobulin molecule or fragment thereof, capable of treating a disease or condition or localizing or targeting a molecule to a site of a disease or condition in the body by performing a function or an action, or stimulating or responding to a function, an action or a reaction, in a biological context (e.g. in an organism, a cell, or an in vitro model thereof). Biologically active molecules may comprise at least one of polypeptides, nucleic acids, small molecules such as small organic or inorganic molecules. 20 [069] A chimeric protein, as used herein, refers to any protein comprised of a first amino acid sequence derived from a first source, bonded, covalently or non covalently, to a second amino acid sequence derived from a second source, wherein the first and second source are not the same. A first source and a second source that are not the same can include two different biological entities, or two different proteins from the same biological entity, or a biological entity and a non-biological entity. A chimeric protein can include for example, a protein derived from at least 2 different biological sources. A biological source can include any non-synthetically produced nucleic acid or amino acid sequence (e.g. a genomic or cDNA sequence, a plasmid or viral vector, a native virion or a mutant or analog, as further described herein, of any of the above). A synthetic source can include a protein or nucleic acid sequence produced chemically and not by a biological system (e.g. solid phase synthesis of amino acid sequences). A chimeric protein can also include a protein derived from at least 2 different synthetic sources or a protein derived from at least one biological source and at least one synthetic source. A chimeric protein may also comprise a first amino acid sequence derived from a first source, covalently or non covalently linked to a nucleic acid, derived from any source or a small organic or inorganic molecule derived from any source. The chimeric protein may comprise a linker molecule between the first and second amino acid sequence or between the first amino acid sequence and the nucleic acid, or between the first amino acid sequence and the small organic or inorganic molecule. [0701 Clotting factor, as used herein, means any molecule, or analog thereof, naturally occurring or recombinanty produced which prevents or decreases 21 the duration of a bleeding episode in a subject with a hemostatic disorder. In other words, it means any molecule having clotting activity. [071] Clotting activity, as used herein, means the ability to participate in a cascade of biochemical reactions that culminates in the formation of a fibrin clot and/or reduces the severity, duration or frequency of hemorrhage or bleeding episode. [072] Dimer as used herein refers to a chimeric protein comprising a first and second polypeptide chain, wherein the first and second chains both comprise a biologically active molecule, and at least a portion of an immunoglobulin constant region. A homodimer refers to a dimer where both biologically active molecules are the same. [0731 Dimerically linked monomer-dimer hybrid refers to a chimeric protein comprised of at least a portion of an immunloglobulin constant region, e.g. an Fc fragment of an immunoglobulin, a biologically active molecule and a linker which links the two together such that one biologically active molecule is bound to 2 polypeptide chains, each comprising a portion of an immunoglobulin constant region. Figure 4 shows an example of a dimerically linked monomer-dimer hybrid. [074] DNA construct, as used herein, means a DNA molecule, or a clone of such a molecule, either single- or double-stranded that has been modified through human intervention to contain segments of DNA combined in a manner that as a whole would not otherwise exist in nature. DNA constructs contain the information necessary to direct the expression of polypeptides of interest. DNA constructs.can include promoters, enhancers and transcription terminators. DNA constructs 22 containing the information necessary to direct the secretion of a polypeptide will also contain at least one secretory signal sequence. [0751 Domain, as used herein, means a region of a polypeptide (including proteins as that term is defined) having some distinctive physical feature or role including for example an independently folded structure composed of one section of a polypeptide chain. A domain may contain the sequence of the distinctive physical feature of the polypeptide or it may contain a fragment of the physical feature which retains its binding characteristics (i.e., it can bind to a second domain). A domain may be associated with another domain. In other words, a first domain may naturally bind to a second domain. [076] A fragment, as used herein, refers to a peptide or polypeptide comprising an amino acid sequence of at least 2 contiguous amino acid residues, of at least 5 contiguous amino acid residues, of at least 10 contiguous amino acid residues, of at least 15 contiguous amino acid residues, of at least 20 contiguous amino acid residues, of at least 25 contiguous amino acid residues, of at least 40 contiguous amino acid residues, of at least 50 contiguous amino acid residues, of at least 100 contiguous amino acid residues, or of at least 200 contiguous amino acid residues or any deletion or truncation of a protein, peptide, or polypeptide. [077] Hemostasis, as used herein, means the stoppage of bleeding or hemorrhage; or the stoppage of blood flow through a blood vessel or body part. [078] Hemostatic disorder, as used herein, means a genetically inherited or acquired condition characterized by a tendency to hemorrhage, either spontaneously or as a result of trauma, due to an impaired ability or inability to form a fibrin clot. 23 [079] Linked, as used herein, refers to a first nucleic acid sequence covalently joined to a second nucleic acid sequence. The first nucleic acid sequence can be directly joined or juxtaposed to the second nucleic acid sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence. Linked as used herein can also refer to a first amino acid sequence covalently, or non-covalently, joined to a second amino acid sequence. The first amino acid sequence can be directly joined or juxtaposed to the second amino acid sequence or alternatively an intervening sequence can covalently join the first amino acid sequence to the second amino acid sequence. [080] Operatively linked, as used herein, means a first nucleic acid sequence linked to a second nucleic acid sequence such that both sequences are capable of being expressed as a biologically active protein or peptide. [081] Polypeptide, as used herein, refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term does not exclude post-expression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation, pegylation, addition of a lipid moiety, or the addition of any organic or inorganic molecule. Included within the definition, are for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids) and polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring. [082] High stringency, as used herein, includes conditions readily determined by the skilled artisan based on, for example, the length of the DNA. 24 Generally, such conditions are defined in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), and include use of a prewashing solution for the nitrocellulose filters 5X SSC, 0.5% SDS, 1.0 mM EDTA (PH 8.0), hybridization conditions of 50% formamide, 6X SSC at 421C (or other similar hybridization solution, such as Stark's solution, in 50% formamide at 42*C, and with washing at approximately 684C, 0.2X SSC, 0.1% SDS. The skilled artisan will recognize that the temperature and wash solution salt concentration can be adjusted as necessary according to factors such as the length of the probe. [083] Moderate stringency, as used herein, include conditions that can be readily determined by those having ordinary skill in the art based on, for example, the length of the DNA. The basic conditions are set forth by Sambrook et al. Molecular Cloning: A Laboratory Manual, 2d ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), and include use of a prewashing solution for the nitrocellulose filters 5X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of 50% formamide, 6X SSC at 420C (or other similar hybridization solution, such as Stark's solution, in 50% formamide at 424C), and washing conditions of 600C, 0.5X SSC, 0.1% SDS. [0841 A small inorganic molecule, as used herein means a molecule containing no carbon atoms and being no larger than 50 kD. [085] A small organic molecule, as used herein means a molecule containing at least one carbon atom and being no larger than 50 kD. [086] Treat, treatment, treating, as used herein means, any of the following: the reduction in severity of a disease or condition; the reduction in the 25 duration of a disease course; the amelioration of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition, the prophylaxis of one or more symptoms associated with a disease or condition. B. Improvements Offered by Certain Embodiments of the Invention [087] The invention provides for chimeric proteins (monomer-dimer hybrids) comprising a first and a second polypeptide chain, wherein said first chain comprises a biologically active molecule and at least a portion of an immunoglobulin constant region, and said second chain comprises at least a portion of an immunoglobulin constant region without any biologically active molecule or variable region of an immunoglobulin. Figure 1 contrasts traditional fusion protein dimers with one example of the monomer-dimer hybrid of the invention. In this example, the biologically active molecule is EPO and the portion of an immunoglobulin is IgG Fc region. [088] Like other chimeric proteins comprised of at least a portion of an immunoglobulin constant region, the invention provides for chimeric proteins which afford enhanced stability and increased bioavailability of the chimeric protein compared to the biologically active molecule alone. Additionally, however, because only one of the two chains comprises the biologically active molecule, the chimeric protein has a lower molecular weight than a chimeric protein wherein all chains comprise a biologically active molecule and while not wishing to be bound by any theory, this may result in the chimeric protein being more readily transcytosed across the epithelium barrier, e.g., by binding to the FcRn receptor thereby increasing the half-life of the chimeric protein. In one embodiment, the invention 26 thus provides for an improved non-invasive method (e.g. via any mucosal surface, such as, orally, buccally, sublingually, nasally, rectally, vaginally, or via pulmonary or occular route) of administering a therapeutic chimeric protein of the invention. The invention thus provides methods of attaining therapeutic levels of the chimeric proteins of the invention using less frequent and lower doses compared to previously described chimeric proteins (e.g. chimeric proteins comprised of at least a portion of an immunoglobulin constant region and a biologically active molecule, wherein all chains of the chimeric protein comprise a biologically active molecule). [089] In another embodiment, the invention provides an invasive method, e.g., subcutaneously, intravenously, of administering a therapeutic chimeric protein of the invention. Invasive administration of the therapeutic chimeric protein of the invention provides for an increased half life of the therapeutic chimeric protein which results in using less frequent and lower doses compared to previously described chimeric proteins (e.g. chimeric proteins comprised of at least a portion of an immunoglobulin constant region and a biologically active molecule, wherein all chains of the chimeric protein comprise a biologically active molecule). [090] Yet another advantage of a chimeric protein wherein only one of the chains comprises a biologically active molecule is the enhanced accessibility of the biologically active molecule for its target cell or molecule resulting from decreased steric hindrance, decreased hydrophobic interactions, decreased ionic interactions, or decreased molecular weight compared to a chimeric protein wherein all chains are comprised of a biologically active molecule. 27 C. Chimeric Proteins [091] The invention relates to chimeric proteins comprising one biologically active molecule, at least a portion of an immunoglobulin constant region, and optionally at least one linker. The portion of an immunoglobulin will have both an N, or an amino terminus, and a C, or carboxy terminus. The chimeric protein may have the biologically active molecule linked to the N terminus of the portion of an immunoglobulin. Alternatively, the biologically active molecule may be linked to the C terminus of the portion of an immunoglobulin. In one embodiment, the linkage is a covalent bond. In another embodiment, the linkage is a non-covalent bond. [092] The chimeric protein can optionally comprise at least one linker; thus, the biologically active molecule does not have to be directly linked to the portion of an immunoglobulin constant region. The linker can intervene in between the biologically active molecule and the portion of an immunoglobulin constant region. The linker can be linked to the N terminus of the portion of an immunoglobulin constant region, or the C terminus of the portion of an immunoglobulin constant region. If the biologically active molecule is comprised of at least one amino acid the biologically active molecule will have an N terminus and a C terminus and the linker can be linked to the N terminus of the biologically active molecule, or the C terminus the biologically active molecule. [093] The invention relates to a chimeric protein of the formula X-La-F:F or F:F-La-X, wherein X is a biologically active molecule, L is an optional linker, F is at least a portion of an immunoglobulin constant region and, a is any integer or zero. The invention also relates to a chimeric protein of the formula Ta-X-La-F:F or Ta-F:F La-X, wherein X is a biologically active molecule, L is an optional linker, F is at least 28 a portion of an immunoglobulin constant region, a is any integer or zero, T is a second linker or alternatively a tag that can be used to facilitate purification of the chimeric protein, e.g., a FLAG tag, a histidine tag, a GST tag, a maltose binding protein tag and (:) represents a chemical association, e.g. at least one non-peptide bond. In certain embodiments, the chemical association, i.e., (:) is a covalent bond. In other embodiments, the chemical association, i.e., (:) is a non-covalent interaction, e.g., an ionic interaction, a hydrophobic interaction, a hydrophilic interaction, a Van der Waals interaction, a hydrogen bond. It will be understood by the skilled artisan that when a equals zero X will be directly linked to F. Thus, for example, a may be 0, 1, 2, 3, 4, 5, or more than 5. [094] In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2a (SEQ ID NO:6). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2b (SEQ ID NO:8). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2c (SEQ ID NO:10). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2d (SEQ ID NO:12). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2e (SEQ ID NO:14). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2f (SEQ ID NO:16). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2g (SEQ ID NO:18). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2h (SEQ ID NO:20). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2i (SEQ ID NO:22). In 29 one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 2j (SEQ ID NO:24). In one embodiment, the chimeric protein of the invention comprises the amino acid sequence of figure 17b (SEQ ID NO: 99). 1. Chimeric Protein Variants [095] Derivatives of the chimeric proteins of the invention, antibodies against the chimeric proteins of the invention and antibodies against binding partners of the chimeric proteins of the invention are all contemplated, and can be made by altering their amino acids sequences by substitutions, additions, and/or deletions/truncations or by introducing chemical modification that result in functionally equivalent molecules. It will be understood by one of ordinary skill in the art that certain amino acids in a sequence of any protein may be substituted for other amino acids without adversely affecting the activity of the protein. [096] Various changes may be made in the amino acid sequences of the chimeric proteins of the invention or DNA sequences encoding therefore without appreciable loss of their biological activity, function, or utility. Derivatives, analogs,. or mutants resulting from such changes and the use of such derivatives is within the scope of the present invention. In a specific embodiment, the derivative is functionally active, i.e., capable of exhibiting one or more activities associated with the chimeric proteins of the invention, e.g., FcRn binding, viral inhibition, hemostasis, production of red blood cells. Many assays capable of testing the activity of a chimeric protein comprising a biologically active molecule are known in the art. Where the biologically active molecule is an HIV inhibitor, activity can be tested by measuring reverse transcriptase activity using known methods (see, e.g., Barre Sinoussi et al. 1983, Science 220:868; Gallo et al. 1984, Science 224:500). 30 Alternatively, activity can be measured by measuring fusogenic activity (see, e.g., Nussbaum et al. 1994, J. Virol. 68(9):5411). Where the biological activity is hemostasis, a StaCLot FVIIa-rTF assay can be performed to assess activity of Factor Vlla derivatives (Johannessen et al. 2000, Blood Coagulation and Fibrinolysis 11:S159). [097] Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs (see Table 1). Furthermore, various amino acids are commonly substituted with neutral amino acids, e.g., alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine (see, e.g., MacLennan et al. 1998, Acta Physiol. Scand. Supply. 643:55-67; Sasaki et al. 1998, Adv. Biophys. 35:1-24). TABLE 1 Original Exemplary Typical Residues Substitutions Substitutions Ala (A) Val, Leu, lle Val Arg (R) Lys, Gin, Asn Lys Asn (N) Gin Gin Asp (D) Glu Glu Cys (C) Ser, Ala Ser Gin (Q) Asn Asn Gly (G) Pro, Ala Ala His (H) Asn, GIn, Lys, Arg Arg Ile (1) Leu, Val, Met, Ala, Leu Phe, Norieucine Leu (L) Norleucine, lIe, Val, Ile Met, Ala, Phe Lys (K) Arg, Arg 1,4-Diamino-butyric Acid, Gin, Asn Met (M) Leu, Phe, Ile Leu 31 Original Exemplary Typical Residues Substitutions Substitutions Phe (F) Leu, Val, lIe, Ala, Tyr Leu Pro (P) Ala Gly Ser (S) Thr, Ala, Cys Thr Thr (T) Ser Ser Trp (W) Tyr, Phe Tyr Tyr (Y) Trp, Phe, Thr, Ser Phe Val (V) lie, Met, Leu, Phe, Ala, Leu Norleucine 2. Biologically Active Molecules [098] The invention contemplates the use of any biologically active molecule as the therapeutic molecule of the invention. The biologically active molecule can be a polypeptide. The biologically active molecule can be a single amino acid. The biologically active molecule can include a modified polypeptide. [099] The biologically active molecule can. include a lipid molecule (e.g. a steroid or cholesterol, a fatty acid, a triacylglycerol, glycerophospholipid, or sphingolipid). The biologically active molecule can include a sugar molecule (e.g. glucose, sucrose, mannose). The biologically active molecule can include a nucleic acid molecule (e.g. DNA, RNA). The biologically active molecule can include a small organic molecule or a small inorganic molecule. a. Cytokines and Growth Factors [0100] In one embodiment, the biologically active molecule is a growth factor, hormone or cytokine or analog or fragment thereof. The biologically active molecule can be any agent capable of inducing cell growth and proliferation. In a specific embodiment, the biologically active molecule is any agent which can induce 32 erythrocytes to proliferate. Thus, one example of a biologically active molecule contemplated by the invention is EPO. The biologically active molecule can also include, but is not limited to, RANTES, MIPla, MIP1@, IL-2, IL-3, GM-CSF, growth hormone, tumor necrosis factor (e.g. TNFa or ). [0101] The biologically active molecule can include interferon a, whether synthetically or recombinantly produced, including but not limited to, any one of the about twenty-five structurally related subtypes, as for example interferon-a2a, now commercially available for clinical use (ROFERON@, Roche) and interferon-a2b also approved for clinical use (INTRON®, Schering) as well as genetically engineered versions of various subtypes, including, but not limited to, commercially available consensus interferon a (INFERGEN@, Intermune, developed by Amgen) and consensus human leukocyte interferon see, e.g., U.S. Patent Nos.: 4,695,623; 4,897,471, interferon P, epidermal growth factor, gonadotropin releasing hormone (GnRH), leuprolide, follicle stimulating hormone, progesterone, estrogen, or testosterone. [01021 A list of cytokines and growth factors which may be used in the chimeric protein of the invention has been previously described (see, e.g., U.S. Patent Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1). b. Antiviral Agents [01031 In one embodiment, the biologically active molecule is an antiviral agent, including fragments and analogs thereof. An antiviral agent can include any molecule that inhibits or prevents viral replication, or inhibits or prevents viral entry into a cell, or inhibits or prevents viral egress from a cell. In one embodiment, the antiviral agent is a fusion inhibitor. In one embodiment, the antiviral agent is a 33 cytokine which inhibits viral replication. In another embodiment, the antiviral agent is interferon a. [0104] The viral fusion inhibitor for use in the chimeric protein can be any molecule which decreases or prevents viral penetration of a cellular membrane of a target cell. The viral fusion inhibitor can be any molecule that decreases or prevents the formation of syncytia between at least two susceptible cells. The viral fusion inhibitor can be any molecule that decreases or prevents the joining of a lipid bilayer membrane of a eukaryotic cell and a lipid bilayer of an enveloped virus. Examples of enveloped virus include, but are not limited to HIV-1, HIV-2, SIV, influenza, parainfluenza, Epstein-Barr virus, CMV, herpes simplex 1, herpes simplex 2 and respiratory syncytia virus. [01051 The viral fusion inhibitor can be any molecule that decreases or prevents viral fusion including, but not limited to, a polypeptide, a small organic molecule or a small inorganic molecule. In one embodiment, the fusion inhibitor is a polypeptide. In one embodiment, the viral fusion inhibitor is a polypeptide of 3-36 amino acids. In another embodiment, the viral fusion inhibitor is a polypeptide of 3 50 amino acids, 10-65 amino acids, 10-75 amino acids. The polypeptide can be comprised of a naturally occurring amino acid sequence (e.g. a fragment of gp4l) including analogs and mutants thereof or the polypeptide can be comprised of an amino acid sequence not found in nature, so long as the polypeptide exhibits viral fusion inhibitory activity: [0106] In one embodiment, the viral fusion inhibitor is a polypeptide, identified as being a viral fusion inhibitor using at least one computer algorithm, e.g., 34 ALLMOTI5, 107x178x4 and PLZIP (see, e.g., U.S. Patent Nos.: 6,013,263; 6,015,881; 6,017,536; 6,020,459; 6,060,065; 6,068,973; 6,093,799; and 6,228,983). [0107] In one embodiment, the viral fusion inhibitor is an HIV fusion inhibitor. In one embodiment, HIV is HIV-1. In another embodiment, HIV is HIV-2. In one embodiment, the HIV fusion inhibitor is a polypeptide comprised of a fragment of the gp41 envelope protein of HIV-1. The HIV fusion inhibitor can comprise, e.g., T20 (SEQ ID NO:1) or an analog thereof, T21 (SEQ ID NO:2) or an analog thereof, T1249 (SEQ ID NO:3) or an analog thereof, NcCGgp 4 l (Louis et al. 2001, J. Biol. Chem. 276:(31)29485) or an analog thereof, or 5 helix (Root et al. 2001, Science 291:884) or an analog thereof. [0108] Assays known in the art can bemused to test for viral fusion inhibiting activity of a polypeptide, a small organic molecule, or a small inorganic molecule. These assays include a reverse transcriptase assay, a p24 assay, or syncytia formation assay (see, e.g., U.S. Patent No. 5,464,933). [0109] A list of antiviral agents which may be used in the chimeric protein of the invention has been previously described (see, e.g., U.S. Patent Nos. 6,086,875, 6,485,726, 6,030,613; WO 03/077834; US2003-0235536A1). c. Hemostatic Agents [0110] In one embodiment, the biologically active molecule is a clotting factor or other agent that promotes hemostasis, including fragments and analogs thereof. The clotting factor can include any molecule that has clotting activity or activates a molecule with clotting activity. The clotting factor can be comprised of a polypeptide. The clotting factor can be, as an example, but not limited to Factor Vill, Factor IX, Factor XI, Factor XII, fibrinogen, prothrombin, Factor V, Factor VII, Factor X, Factor 35 XIII or von Willebrand Factor. In one embodiment, the clotting factor is Factor VII or Factor Vila. The clotting factor can be a factor that participates in the extrinsic pathway. The clotting factor can be a factor that participates in the intrinsic pathway. Alternatively, the clotting factor can be a factor that participates in both the extrinsic and intrinsic pathway. [0111] The clotting factor can be a human clotting factor or a non-human clotting factor, e.g., derived from a non-human primate, a pig or any mammal. The clotting factor can be chimeric clotting factor, e.g., the clotting factor can comprise a portion of a human clotting factor and a portion of a porcine clotting factor or a portion of a first non-human clotting factor and a portion of a second non-human clotting factor. [0112] The clotting factor can be an activated clotting factor. Alternatively, the clotting factor can be an inactive form of a clotting factor, e.g., a zyniogen. The inactive clotting factor can undergo activation subsequent to being linked to at least a portion of an immunoglobulin constant region. The inactive clotting factor can be activated subsequent to administration to a subject. Alternatively, the inactive clotting factor can be activated prior to administration. [0113 In certain embodiments an endopeptidase, e.g., paired basic amino acid cleaving enzyme (PACE), or any PACE family member, such as PCSK1-9, including truncated versions thereof, or its yeast equivalent Kex2 from S. cerevisiae and truncated versions of Kex2 (Kex2 1-675) (see, e.g., U.S. Patent Nos. 5,077,204; 5,162,220; 5,234,830; 5,885,821; 6,329,176)-may be used to cleave a propetide to form the mature chimeric protein of the invention (e.g. factor VII, factor IX). 36 d. Other Proteinaceous Biologically Active Molecules [0114] In one embodiment, the biologically active molecule is a receptor or a fragment or analog thereof. The receptor can be expressed on a cell surface, or alternatively the receptor can be expressed on the interior of the cell. The receptor can be a viral receptor, e.g., CD4, CCR5, CXCR4, CD21, CD46. The biologically active molecule can be a bacterial receptor. The biologically active molecule can be an extra-cellular matrix protein or fragment or analog thereof, important in bacterial colonization and infection (see, e.g., U.S. Patent Nos.: 5,648,240; 5,189,015; 5,175,096) or a bacterial surface protein important in adhesion and infection (see, e.g., U.S. Patent No. 5,648,240). The biologically active molecule can be a growth factor, hormone or cytokine receptor, or a fragment or analog thereof, e.g., TNFa receptor, the erythropoietin receptor, CD25, CD122, or CD132. [0115] A list of other proteinaceous molecules which may be used in the chimeric protein of the invention has been previously described (see, e.g., U.S. Patent Nos. 6,086,875; 6,485,726; 6,030,613; WO 03/077834; US2003-0235536A1). e. Nucleic Acids [01161 In one embodiment, the biologically active molecule is a nucleic acid, e.g., DNA, RNA. In one specific embodiment, the biologically active molecule is a nucleic acid that can be used in RNA interference (RNAi). The nucleic acid molecule can be as an example, but not as a limitation, an anti-sense molecule or a ribozyme or an aptamer. [0117] Antisense RNA and DNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation. Antisense approaches involve the design of oligonucleotides that are 37 complementary to a target gene mRNA. The antisense oligonucleotides will bind to the complementary target gene mRNA transcripts and prevent translation. Absolute complementarily, is not required. [0118] A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. [01191 Antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides. [0120] The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as polypeptides (e.g. for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. 1989, Proc. Natl. Acad. Sci. USA 86:6553; 38 Lemaitre et al. 1987, Proc. Natl. Acad. Sci: USA 84:648; WO 88/09810,) or the blood-brain barrier (see, e.g., WO 89/10134), hybridization-triggered cleavage agents (see, e.g., Krol et al. 1988, BioTechniques 6:958) or intercalating agents (see, e.g., Zon 1988, Pharm. Res. 5:539). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a polypeptide, hybridization triggered cross linking agent, transport agent, or hybridization-triggered cleavage agent. [0121] Ribozyme molecules designed to catalytically cleave target gene mRNA transcripts can also be used to prevent translation of target gene mRNA and, therefore, expression of target gene product. (See, e.g., WO 90/11364; Sarver et al. 1990, Science 247, 1222-1225). [0122] Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. (See Rossi 1994, Current Biology 4:469). The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary-target RNA, followed by an endonucleolytic cleavage event. The composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include the well known catalytic sequence responsible for mRNA cleavage. For this sequence, see, e.g., U.S. Pat. No. 5,093,246. [0123 In one embodiment, ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy target gene mRNAs. In another embodiment, the use of hammerhead ribozymes is contemplated. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction 39 and production of hammerhead ribozymes is well known in the art and is described more fully in Myers 1995, Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, New York, and in Haseloff and Gerlach 1988, Nature, 334:585. f. Small Molecules [01241 The invention also contemplates the use of any therapeutic small molecule or drug as the biologically active molecule in the chimeric protein of the invention. A list of small molecules and drugs which may be used in the chimeric protein of the invention has been previously described (see, e.g., U.S. Patent Nos. 6,086,875; 6,485,726; 6,030,613; WO 03/077834; US2003-0235536A1). 2. Immunoglobulins [0125] The chimeric proteins of the invention comprise at least a portion of an immunoglobulin constant region. Immunoglobulins are comprised of four protein chains that associate covalently-two heavy chains and two light chains. Each chain is further comprised of one variable region and one constant region. Depending upon the immunoglobulin isotype, the heavy chain constant region is comprised of 3 or 4 constant region domains (e.g. CHI, CH2, CH3, CH4). Some isotypes are further comprised of a hinge region. [0126] The portion of an immunoglobulin constant region can be obtained from any mammal. The portion of an immunoglobulin constant region can include a portion of a human immunoglobulin constant region, a non-human primate immunoglobulin constant region, a bovine immunoglobulin constant region, a 40 porcine immunoglobulin constant region, a-murine immunoglobulin constant region, an ovine immunoglobulin constant region or a rat immunoglobulin constant region. [0127] The portion of an immunoglobulin constant region can be produced recombinantly or synthetically. The immunoglobulin can be isolated from a cDNA library. The portion of an immunoglobulin constant region can be isolated from a phage library (See, e.g., McCafferty et al. 1990, Nature 348:552, Kang et al. 1991, Proc. Nati. Acad. Sci. USA 88:4363; EP 0 589 877 B1). The portion of an immunoglobulin constant region.can be obtained by gene shuffling of known sequences (Mark et al. 1992, Bio/Technol. 10:779). The portion of an immunoglobulin constant region can be isolated by in vivo recombination (Waterhouse et al. 1993, Nucl. Acid Res. 21:2265). The immunoglobulin can be a humanized immunoglobulin (U.S. Patent No. 5,585,089, Jones et al. 1986, Nature 332:323). [0128] The portion of an immunoglobulin constant region can include a portion of an IgG, an IgA, an IgM, an IgD, or an IgE. In one embodiment, the immunoglobulin is an igG. In another embodiment, the immunoglobulin is IgG1. In another embodiment, the immunoglobulin is IgG2. [0129] The portion of an immunoglobulin constant region can include the entire heavy chain constant region, or a fragment or analog thereof. In one embodiment, a heavy chain constant region can comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a hinge region. In another embodiment, a heavy chain constant region can comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a CH4 domain. 41 [0130] The portion of an immunoglobulin constant region can include an Fc fragment. An Fc fragment can be comprised of the CH2 and CH3 domains of an immunoglobulin and the hinge region of the immunoglobulin. The Fc fragment can be the Fc fragment of an IgG1, an IgG2, an IgG3 or an IgG4. In one specific embodiment, the portion of an immunoglobulin constant region is an Fc fragment of an IgG1. In another embodiment, the portion of an immunoglobulin constant region is an Fc fragment of an IgG2. [0131] In another embodiment, the portion of an immunoglobulin constant region is an Fc neonatal receptor (FcRn) binding partner. An FcRn binding partner is any molecule that can be specifically bound by the FcRn receptor with consequent active transport by the FcRn receptor of the FcRn binding partner. Specifically bound refers to two molecules forming a complex that is relatively stable under physiologic conditions. Specific binding is characterized by a high affinity and a low to moderate capacity as distinguished from nonspecific binding which usually has a low affinity with a moderate to high capacity. Typically, binding is considered specific when the affinity constant KA is higher than 106 M 1 , or more preferably higher than 108 M 1 . If necessary, non-specific binding can be reduced without substantially affecting specific binding by varying the binding conditions. 'The appropriate binding conditions such as concentration of the molecules, ionic strength of the solution, temperature, time allowed for binding, concentration of a blocking agent (e.g. serum albumin, milk casein), etc., may be optimized by a skilled artisan using routine techniques. [0132] The FcRn receptor has been isolated from several mammalian species including humans. The sequences of the human FcRn, monkey FcRn rat FcRn, and 42 mouse FcRn are known (Story et al. 1994, J. Exp. Med. 180:2377). The FcRn receptor binds IgG (but not other immunoglobulin classes such as IgA, IgM, IgD, and IgE) at relatively low pH, actively transports the IgG transcellularly in a luminal to serosal direction, and then releases the IgG at relatively higher pH found in the interstitial fluids. It is expressed in adult epithelial tissue (U.S. Patent Nos. 6,485,726, 6,030,613, 6,086,875; WO 03/077834; US2003-0235536A1) including lung and intestinal epithelium (Israel et al. 1997, Immunology 92:69) renal proximal tubular epithelium (Kobayashi et al. 2002, Am. J. Physiol. Renal Physiol. 282:1F358) as well as nasal epithelium, vaginal surfaces, and biliary tree surfaces. [0133] FcRn binding partners of the present invention encompass any molecule that can be specifically bound by the FcRn receptor including whole IgG, the Fc fragment of lgG, and other fragments that include the complete binding region of the FcRn receptor. The region of the Fc portion of IgG that binds to the FcRn receptor has been described based on X-ray crystallography (Burmeister et al. 1994, Nature 372:379). The major contact area of the Fc with the FcRn is near the junction of the CH2 and CH3 domains. Fc-FcRn contacts are all within a single Ig heavy chain. The FcRn binding partners include whole IgG, the Fc fragment of IgG, and other fragments of IgG that include the complete binding region of FcRn. The major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290 291, 308-311, and 314 of the CH2 domain and amino acid residues 385-387, 428, and 433-436 of the CH3 domain. References made to amino acid numbering of immunoglobulins or immunoglobulin fragments, or regions, are all based on Kabat et al. 1991, Sequences of Proteins of Immunological Interest, U.S. Department of Public Health, Bethesda, MD. 43 [0134] The Fc region of IgG can be modified according to well recognized procedures such as site directed mutagenesis and the like to yield modified IgG or Fc fragments or portions thereof that will be bound by FcRn. Such modifications include modifications remote from the FcRn contact sites as well as modifications within the contact sites that preserve or even enhance binding to the FcRn. For example, the following single amino acid residues in human IgG1 Fc (Fcyl) can be substituted without significant loss of Fc binding affinity for FcRn: P238A, S239A, K246A, K248A, D249A, M252A, T256A, E258A, T260A, D265A, S267A, H268A, E269A, D270A, E272A, L274A, N276A, Y278A, D280A, V282A, E283A, H285A, N286A, T289A, K290A, R292A, E293A, E294A, Q295A, Y296F, N297A, S298A, Y300F, R301A, V303A, V305A, T307A, L309A, Q311A, D312A, N315A, K317A, E318A, K320A, K322A, S324A, K326A, A327Q, P329A, A330Q, P331A, E333A, K334A, T335A, S337A, K338A, K340A, Q342A, R344A, E345A, Q347A, R355A, E356A, M358A, T359A, K360A, N361A, Q362A, Y373A, S375A, D376A, A378Q, E380A, E382A, S383A ,N384A, Q386A, E388A, N389A, N390A, Y391F, K392A, L398A, S400A, D401A, D413A, K414A, R416A, Q418A, Q419A, N421A, V422A, S424A, E430A, N434A, T437A, Q438A, K439A, S440A, S444A, and K447A, where for example P238A represents wildtype proline substituted by alanine at position number 238. As an example, one specifc embodiment, incorporates the N297A mutation, removing a highly conserved N-glycosylation site. In addition to alanine other amino acids may be substituted for the wildtype amino acids at the positions specified above. Mutations may be introduced singly into Fc giving rise to more than one hundred FcRn binding partners distinct from native Fc. Additionally, combinations of two, three, or more of these individual mutations may be introduced 44 together, giving rise to hundreds more FcRn binding partners. Moreover, one of the FcRn binding partners of the monomer-dimer hybrid may be mutated and the other FcRn binding partner not mutated at all, or they both may be mutated but with different mutations. Any of the mutations described herein, including N297A, may be used to modify Fc, regardless of the biologically active molecule (e.g., EPO, IFN, Factor IX, T20). [01351 Certain of the above mutations may confer new functionality upon the FcRn binding partner. For example, one embodiment incorporates N297A, removing a highly conserved N-glycosylation site. The effect of this mutation is to reduce immunogenicity, thereby enhancing circulating half life of the FcRn binding partner, and to render the FcRn binding partner incapable of binding to FcyRI, FcyRIIA, FcyRIlB, and FcyRIIIA, without compromising affinity for FcRn (Routledge et al. 1995, Transplantation 60:847; Friend et al. 1999, Transplantation 68:1632; Shields et al. 1995, J. Biol. Chem. 276:6591). As a further example of new functionality arising from mutations described above affinity for FcRn may be increased beyond that of wild type in some instances. This increased affinity may reflect an increased "on" rate, a decreased "off' rate or both an increased "on" rate and a decreased "off' rate. Mutations believed to impart an increased affinity for FcRn include T256A, T307A, E380A, and N434A (Shields et al. 2001, J. Biol. Chem. 276:6591). [01361 Additionally, at least three human F c gamma receptors appear to recognize a binding site on IgG within the lower hinge region, generally amino acids 234-237. Therefore, another example of new functionality and potential decreased immunogenicity may arise from mutations of this region, as for example by replacing 45 amino acids 233-236 of human IgG1 "ELLG" (SEQ ID NO: 84) to the corresponding sequence from IgG2 "PVA" (with one amino acid deletion). It has been shown that FcyRI, FcyRIl, and FcyRIll, which mediate various effector functions will not bind to IgG1 when such mutations have been introduced. Ward and Ghetie 1995, Therapeutic Immunology 2:77 and Armour et al.1999, Eur. J. Immunol. 29:2613. [0137] In one embodiment, the FcRn binding partner is a polypeptide including the sequence PKNSSMISNTP (SEQ ID NO:26) and optionally further including a sequence selected'from HQSLGTQ (SEQ ID NO:27), HQNLSDGK (SEQ ID NO:28), HQNISDGK (SEQ ID NO:29), or VISSHLGQ (SEQ ID NO:30) (U.S. Patent No. 5,739,277). [01381 Two FcRn receptors can bind a single Fc molecule. Crystallographic data suggest that each FcRn molecule binds a single polypeptide of the Fc homodimer. In one embodiment, linking the FcRn binding partner, e.g., an Fc fragment of an IgG, to a biologically active molecule provides a means of delivering the biologically active molecule orally, buccally, sublingually, rectally, vaginally, as an aerosol administered nasally or via a pulmonary route, or via an ocular route. In another embodiment, the chimeric protein can be administered invasively, e.g., subcutaneously, intravenously. [0139] The skilled artisan will understand that portions of an immunoglobulin constant region for use in the chimeric protein of the invention can include mutants or analogs thereof, or can include chemically modified immunoglobulin constant regions (e.g. pegylated), or fragments thereof (see, e.g., Aslam and Dent 1998, Bioconjugation: Protein Coupling Techniques For the Biomedical Sciences Macmilan Reference, London). In one instance, a mutant can provide for enhanced binding of 46 an FcRn binding partner for the FcRn. Also contemplated for use in the chimeric protein of the invention are peptide mimetics of at least a portion of an immunoglobulin constant region, e.g., a peptide mimetic of an Fc fragment or a peptide mimetic of an FcRn binding partner. In one embodiment, the peptide mimetic is identified using phage display or via chemical library screening (see, e.g., McCafferty et a/. 1990, Nature 348:552, Kang et al. 1991, Proc. Nati. Acad. Sci. USA 88:4363; EP 0 589 877 B1). 3. Optional Linkers [0140] The chimeric protein of the invention can optionally comprise at least one linker molecule. The linker can be comprised of any organic molecule. In one embodiment, the linker is polyethylene glycol (PEG). In another embodiment, the linker is comprised of amino acids. The linker can comprise 1-5 amino acids, 1-10 amino acids, 1-20 amino acids, 10-50 amino acids, 50-100 amino acids, 100-200 amino acids. In one embodiment, the linker is the eight amino acid linker EFAGAAAV (SEQ ID NO:31). Any of the linkers described herein may be used in the chimeric protein of the invention, e.g., a monomer-dimer hybrid, including EFAGAAAV (SEQ ID NO: 31), regardless of the biologically active molecule (e.g. EPO, IFN, Factor IX). [0141] The linker can comprise the sequence G, (SEQ ID NO: 85). The linker can comprise the sequence (GA), (SEQ ID NO:32). The linker.can comprise the sequence (GGS)n (SEQ ID NO:33). The linker can comprise the sequence (GGS)n(GGGGS), (SEQ ID NO:34). In these instances, n may be an integer from 1 10, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. Examples of linkers include, but are not limited to, GGG (SEQ ID NO:35), SGGSGGS (SEQ ID NO:36), GGSGGSGGSGGSGGG 47 (SEQ ID NO:37), GGSGGSGGGGSGGGGS (SEQ ID NO:38), GGSGGSGGSGGSGGSGGS (SEQ ID NO:39). The linker does not eliminate or diminish the biological activity of the chimeric protein. Optionally, the linker enhances the biological activity of the chimeric protein, e.g., by further diminishing the effects of steric hindrance and making the biologically active molecule more accessible to its target binding site. [0142) In one specific embodiment, the linker for interferon a is 15-25 amino acids long. In another specific embodiment, the linker for interferon a is 15-20 amino acids long. In another specific embodiment, the linker for interferon a is 10-25 amino acids long. In another specific embodiment, the linker for interferon a is 15 amino acids long. In one embodiment, the linker for interferon a is (GGGGS)n (SEQ ID NO:40) where G represents glycine, S represents serine and n is an integer from 1 10. In a specific embodiment, n is 3 (SEQ ID NO: 60). [0143] The linker may also incorporate a moiety capable of being cleaved either chemically (e.g. hydrolysis of an ester bond), enzymatically (i.e. incorporation of a protease cleavage sequence) or photolytically (e.g.,a chromophore such as 3 amino-3-(2-nitrophenyl) proprionic acid (ANP)) in order to release the biologically active molecule from the Fc protein. 4. Chimeric Protein Dimerization Using Specific Binding Partners [0144] In one embodiment, the chimeric protein of the invention comprises a first polypeptide chain comprising at least a first domain, said first domain having at least one specific binding partner, and a second polypeptide chain comprising at least a second domain, wherein said second domain, is a specific binding partner of said first domain. The chimeric protein thus comprises a polypeptide capable of 48 dimerizing with another polypeptide due to the interaction of the first domain and the second domain. Methods of dimerizing antibodies using heterologous domains are known in the art (U.S. Patent Nos.: 5,807,706 and 5,910,573; Kostelny et al. 1992, J. Immunol. 148(5):1547). [01451 Dimerization can occur by formation of a covalent bond, or alternatively a non-covalent bond, e.g., hydrophobic interaction, Van der Waal's forces, interdigitation of amphiphilic peptides such as, but not limited to, alpha helices, charge-charge interactions of amino acids bearing opposite charges, such as, but not limited to, lysine and aspartic acid, arginine and glutamic acid. In one embodiment, the domain is a helix bundle comprising a helix, a turn and another helix. In another embodiment, the domain is a leucine zipper comprising a peptide having several repeating amino acids in which every seventh amino acid is a leucire residue. In one embodiment, the specific binding partners are fos/jun. (see Branden et al. 1991, Introduction To Protein Structure, Garland Publishing, New York). [01461 In another embodiment, binding is mediated by a chemical linkage (see, e.g., Brennan et al. 1985, Science 229:81). In this embodiment, intact immunoglobulins, or chimeric proteins comprised of at least a portion of an immunoglobulin constant region are cleaved to generate heavy chain fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the TNB derivatives is then reconverted to the heavy chain fragment thiol by reduction with mercaptoethylamine and is then mixed with an equimolar amount of the other TNB derivative to form a chimeric dimer. 49 D. Nucleic Acids [0147] The invention relates to a first nucleic acid construct and a second nucleic acid construct each comprising a nucleic acid sequence encoding at least a portion of the chimeric protein of the invention. In one embodiment, the first nucleic acid construct comprises a nucleic acid sequence encoding a portion of an immunoglobulin constant region operatively linked to a second DNA sequence encoding a biologically active molecule, and said second DNA construct comprises a DNA sequence encoding an immunoglobulin constant region without the second DNA sequence encoding a biologically active molecule. [01481 The biologically active molecule can include, for example, but not as a limitation, a viral fusion inhibitor, a clotting factor, a growth factor or hormone, or a receptor, or analog, or fragment of any of the preceding. The nucleic acid sequences can also include additional sequences or elements known in the art (e.g., promoters, enhancers, poly A sequences, affinity tags). In one embodiment, the nucleic acid sequence of the second construct can optionally include a nucleic acid sequence encoding a linker placed between the nucleic acid sequence encoding the biologically active molecule and the portion of the immunoglobulin constant region. The nucleic acid sequence of the second DNA construct can optionally include a linker sequence placed before or after the nucleic acid sequence encoding the biologically active molecule and/or the portion of the immunoglobulin constant region. [0149] In one embodiment, the nucleic acid construct is comprised of DNA. In another embodiment, the nucleic acid construct is comprised of RNA. The nucleic acid construct can be a vector, e.g., a viral vector or a plasmid. Examples of viral 50 vectors include, but are not limited to adeno virus vector, an adeno associated virus vector or a murine leukemia virus vector. Examples of plasmids include but are not limited to pUC, pGEM and pGEX. [0150] In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3a (SEQ ID NO:7). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3b (SEQ ID NO:9 ). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3c (SEQ ID NO:1 1). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3d (SEQ ID NO:13). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3e (SEQ ID NO:15). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3f (SEQ ID NO:17). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3g (SEQ ID NO:19). In one embodimentthe nucleic acid construct comprises the nucleic acid sequence of figure 3h (SEQ ID NO:21). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3i (SEQ ID NO:23). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 3j (SEQ ID NO:25). In one embodiment, the nucleic acid construct comprises the nucleic acid sequence of figure 17a (SEQ ID NO: 98). [01511 Due to the known degeneracy of the genetic code, wherein more than one codon can encode the same amino acid, a DNA sequence can vary from that shown in SEQ ID NOS:7, 9, 11, 13, 15, 17, 19, 21, 23, 25 or 98 and still encode a polypeptide having the corresponding amino acid sequence of SEQ ID NOS:6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 99 respectively. Such variant DNA sequences can 51 result from silent mutations (e.g. occurring during PCR amplification), or can be the product of deliberate mutagenesis of a native sequence. The invention thus provides isolated DNA sequences encoding polypeptides of the invention, chosen from: (a) DNA comprising the nucleotide sequence of SEQ ID NOS:7, 9, 11, 13, 15, 17, 19, 21, 23, 25 or 98; (b) DNA encoding the polypeptides of SEQ ID NOS:6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 99; (c) DNA capable of hybridization to a DNA of (a) or (b) under conditions of moderate stringency and which encodcs polypeptides of the invention; (d) DNA capable of hybridization to a DNA of (a) or (b) under conditions of high stringency and which encodes polypeptides of the invention, and (e) DNA which is degenerate as a result of the genetic code to a DNA defined in (a), (b), (c), or (d) and which encode polypeptides of the invention. Of course, polypeptides encoded by such DNA sequences are encompassed by the invention. [0152] In another embodiment, the nucleic acid molecules comprising a sequence encoding the chimeric protein of the invention can also comprise nucleotide sequences that are at least 80% identical to a native sequence. Also contemplated are embodiments in which a nucleic acid molecules comprising a sequence encoding the chimeric protein of the invention comprises a sequence that is at least 90% identical, at least 95% identical, at least 98% identical, at least 99% identical, or at least 99.9% identical to a native sequence. A native sequence can include any DNA sequence not altered by the human hand. The percent identity may be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. 1984, Nucl. Acids Res. 12:387, and available from the University of 52 Wisconsin Genetics Computer Group (UWGCG). The preferred default parameters for the GAP program include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non identities) for nucleotides, and the weighted comparison matrix of Gribskov and Burgess 1986, Nucl. Acids Res. 14:6745, as described by Schwartz and Dayhoff, eds. 1979, Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps. Other programs used by one skilled in the art of sequence comparison may also be used. E. Synthesis of Chimeric Proteins [0153] Chimeric proteins comprising at least a portion of an immunoglobulin constant region and a biologically active molecule can be synthesized using techniques well known in the art. For example, the chimeric proteins of the invention can be synthesized recombinantly in cells (see, e.g., Sambrook et al. 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al. 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y.). Alternatively, the chimeric proteins of the invention can be synthesized using known synthetic methods such as solid phase synthesis. Synthetic techniques are well known in the art (see, e.g., Merrifield, 1973, Chemical Polypeptides, (Katsoyannis and Panayotis eds.) pp. 335-61; Merrifield 1963, J. Am. Chem. Soc. 85:2149; Davis et al. 1985, Biochem. Intl. 10:394; Finn et al. 1976, The Proteins (3d ed.) 2:105; Erikson et al. 1976; The Proteins (3d ed.) 2:257; U.S. Patent No. 3,941,763. Alternatively, the chimeric proteins of the invention can be synthesized using a combination of recombinant and synthetic 53 methods. In certain applications, it may be beneficial to use either a recombinant method or a combination of recombinant and synthetic methods. [0154] Nucleic acids encoding a biologically active molecule can be readily synthesized using recombinant techniques well known in the art. Alternatively, the peptides themselves can be chemically synthesized. Nucleic acids of the invention may be synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. 1988, Nucl. Acids Res. 16:3209, methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports as described in Sarin et al. 1988, Proc. Nati. Acad. Sci. USA 85:7448. Additional methods of nucleic acid synthesis are known in the art. (see, e.g., U.S. Patent Nos. 6,015,881; 6,281,331; 6,469,136). [0155] DNA sequences encoding immunoglobulin constant regions, or fragments thereof, may be cloned from a variety of genomic or cDNA libraries known in the art. The techniques for isolating such DNA sequences using probe-based methods are conventional techniques and are well known to those skilled in the art. Probes for isolating such DNA sequences may be based on published DNA sequences (see, for example, Hieter et al. 1980, Ce// 22:197-207). The polymerase chain reaction (PCR) method disclosed by Mullis et al. (U.S. Patent No. 4,683,195) and Mullis (U.S. Patent No. 4,683,202) may be used. The choice of library and selection of probes for the isolation of such DNA sequences is within the level of ordinary skill in the art. Alternatively, DNA sequences encoding immunoglobulins or 54 fragments thereof can be obtained from vectors known in the art to contain immunoglobulins or fragments thereof. [0156] For recombinant production, a first polynucleotide sequence encoding a portion of the chimeric protein of the invention (e.g. a portion of an immunoglobulin constant region) and a second polynucleotide sequence encoding a portion of the chimeric protein of the invention (e.g. a portion of an immunoglobulin constant region and a biologically active molecule) are inserted into appropriate expression vehicles, i.e. vectors which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an- RNA viral vector, the necessary elements for replication and translation. The nucleic acids encoding the chimeric protein are inserted into the vector in proper reading frame. [0157] The expression vehicles are then transfected or co-transfected into a suitable target cell, which will express the polypeptides. Transfection techniques known in the art include, but are not limited to, calcium phosphate precipitation (Wigler et al. 1978, Cell 14:725) and electroporation (Neumann et al. 1982, EMBO, J. 1:841), and liposome based reagents. A variety of host-expression vector systems may be utilized to express the chimeric proteins described herein including both prokaryotic or eukaryotic cells. These include, but are not limited to, microorganisms such as bacteria (e.g. E. coli) transformed with recombinant bacteriophage DNA or plasmid DNA expression vectors containing an appropriate coding sequence; yeast or filamentous fungi transformed with recombinant yeast or fungi expression vectors containing an appropriate coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g. baculovirus) containing an appropriate coding sequence; plant cell systems infected with 55 recombinant virus expression vectors (e.g. cauliflower mosaic virus or tobacco mosaic virus) or transformed with recombinant plasmid expression vectors (e.g. Ti plasmid) containing an appropriate coding sequence; or animal cell systems, including mammalian cells (e.g. CHO, Cos, HeLa cells). [0158] When the chimeric protein of the invention is recombinantly synthesized in a prokaryotic cell it may be desirable to refold the chimeric protein. The chimeric protein produced by this method can be refolded to a biologically active conformation using conditions known in the art, e.g., denaturing under reducing conditions and then dialyzed slowly into PBS. [0159] Depending on the expression system used, the expressed chimeric protein is then isolated by procedures well-established in the art (e.g. affinity chromatography, size exclusion chromatography, ion exchange chromatography). [0160] The expression vectors can encode for tags that permit for easy purification of the recombinantly produced chimeric protein. Examples include, but are not limited to vector pUR278 (Ruther et al. 1983, EMBO J. 2:1791) in which the chimeric protein described herein coding sequences may be ligated into the vector in frame with the lac z coding region so that a hybrid protein is produced; pGEX vectors may be used to express chimeric proteins of the invention with a glutathione S-transferase (GST) tag. These proteins are usually soluble and can easily be purified from cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. The vectors include cleavage sites (thrombin or Factor Xa protease or PreScission ProteaseTm (Pharmacia, Peapack, N.J.)) for easy removal of the tag after purification. 56 [0161] To increase efficiency of production, the polynucleotides can be designed to encode multiple units of the chimeric protein of the invention separated by enzymatic cleavage sites. The resulting polypeptide can be cleaved (e.g. by treatment with the appropriate enzyme) in order to recover the polypeptide units. This can increase the yield of polypeptides driven by a single promoter. When used in appropriate viral expression systems, the translation of each polypeptide encoded by the mRNA is directed internally in the transcript; e.g., by an internal ribosome entry site, IRES. Thus, the polycistronic construct directs the transcription of a single, large polycistronic mRNA which, in turn, directs the translation of multiple, individual polypeptides. This approach eliminates the production and enzymatic processing of polyproteins and may significantly increase yield of polypeptide driven by a single promoter. [0162] Vectors used in transformation will usually contain a selectable marker used to identify transformants. In bacterial systems, this can include an antibiotic resistance gene such as ampicillin or kanamycin. Selectable markers for use in cultured mammalian cells include genes that confer resistance to drugs, such as neomycin, hygromycin, and methotrexate. The selectable marker may be an amplifiable selectable marker. One amplifiable selectable marker is the DHFR gene. Another amplifiable marker is the DHFR cDNA (Simonsen and Levinson 1983, Proc. Natl. Acad. Sci. USA 80:2495). Selectable markers are reviewed by Thilly (Mammalian Cell Technology, Butterworth Publishers, Stoneham, MA) and the choice of selectable markers is well within the level of ordinary skill in the art. [0163] Selectable markers may be introduced into the cell on a separate plasmid at the same time as the gene of interest, or they may be introduced on the 57 same plasmid. If on the same plasmid, the selectable marker and the gene of interest may be under the control of different promoters or the same promoter, the latter arrangement producing a dicistronic message. Constructs of this type are known in the art (for example, U.S. Pat. No. 4,713,339). [0164] The expression elements of the expression systems vary in their strength and specificities. Depending on the host/vector system utilized, any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used in the expression vector. For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage A, plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used; when cloning in insect cell systems, promoters such as the baculovirus polyhedron promoter may be used; when cloning in plant cell systems, promoters derived from the genome of plant cells (e.g. heat shock promoters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses (e.g. the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be used; when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses (e.g. the adenovirus late promoter; the vaccinia virus 7.5 K promoter) may be used; when generating cell lines that contain multiple copies of expression product, SV40-, BPV and EBV-based vectors may be used with an appropriate selectable marker. [0165] In cases where plant expression vectors are used, the expression of sequences encoding linear or non-cyclized forms of the chimeric proteins of the invention may be driven by any of a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al. 58 1984, Nature 310:511-514), or the coat protein promoter of TMV (Takamatsu et al. 1987, EMBO J. 6:307-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al. 1984, EMBO J. 3:1671-1680; Broglie et al. 1984, Science 224:838-843) or heat shock promoters, e.g., soybean hspl7.5-E or hsp17.3-B (Gurley et al. 1986, Mol. Cell. Biol. 6:559-565) may be used. These constructs can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. For reviews of such techniques see, e.g., Weissbach & Weissbach 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section Vill, pp. 421-463; and Grierson & Corey 1988, Plant Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9. [0166] In one insect expression system that may be used to produce the chimeric proteins of the invention, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express the foreign genes. The virus grows in Spodoptera frugiperda cells. A coding sequence may be cloned into non-essential regions (for example, the polyhedron gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of a coding sequence will result in inactivation of the polyhedron gene and production of non-occluded recombinant virus (i.e. virus lacking the proteinaceous coat coded for by the polyhedron gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. (see, e.g., Smith et al. 1983, J. Virol. 46:584; U.S. Patent No. 4,215,051). Further examples of this expression system may be found in Ausubel et al., eds. 1989, Current Protocols in Molecular Biology, Vol. 2, Greene Publish. Assoc. & Wiley Interscience. 59 [0167] Another system which can be used to express the chimeric proteins of the invention is the glutamine synthetase gene expression system, also referred to as the "GS expression system" (Lonza Biologics PLC, Berkshire UK). This expression system is described in detail in U.S. Patent No. 5,981,216. [0168] In mammalian host cells, a number of viral based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, a coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g. region El or E3) will result in a recombinant virus that is viable and capable of expressing peptide in infected hosts (see, e.g., Logan & Shenk 1984, Proc. Nat. Acad. Sci. USA 81:3655). Alternatively, the vaccinia 7.5 K promoter may be used (see, e.g., Mackett et al. 1982, Proc. Natl. Acad. Sci. USA 79:7415; Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc. Natl. Acad. Sci. USA 79:4927). [0169] In cases where an adenovirus is used as an expression vector, a coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g. region El or E3) will result in a recombinant virus that is viable and capable of expressing peptide in infected hosts (see, e.g., Logan & Shenk 1984, Proc. Natl. Acad. Sci. USA 81:3655). Alternatively, the vaccinia 7.5 K promoter may be used (see, e.g., Mackett et al. 60 1982, Proc. Nat!. Acad. Sci.- USA 79:7415; Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc. Nat. Acad. Sci. USA 79:4927). [0170] Host cells containing DNA constructs of the chimeric protein are grown in an appropriate growth medium. As used herein, the term "appropriate growth medium" means a medium containing nutrients required for the growth of cells. Nutrients required for cell growth may include a carbon source, a nitrogen source, essential amino acids, vitamins, minerals and growth factors. Optionally the media can contain bovine calf serum or fetal calf serum. In one embodiment, the media contains substantially no IgG. The growth medium will generally select for cells containing the DNA construct by, for example, drug selection or deficiency in an essential nutrient which is complemented by the selectable marker on the DNA construct or co-transfected with the DNA construct. Cultured mammalian cells are generally grown in commercially available serum-containing or serum-free media (e.g. MEM, DMEM). Selection of a medium appropriate for the particular cell line used is within the level of ordinary skill in the art. [0171] The recombinantly produced chimeric protein of the invention can be isolated from the culture media. The culture medium from appropriately grown transformed or transfected host cells is separated from the cell material, and the presence of chimeric proteins is demonstrated. One method of detecting the chimeric proteins, for example, is by the binding of the chimeric proteins or portions of the chimeric proteins to a specific antibody recognizing the chimeric protein of the invention. An anti-chimeric protein antibody may be a monoclonal or polyclonal antibody raised against the chimeric protein in question. For example, the chimeric protein contains at least a portion of an immunoglobulin constant region. Antibodies 61 recognizing the constant region of many immunoglobulins are known in the art and are commercially available. An antibody can be used to perform an ELISA or a western blot to detect the presence of the chimeric protein of the invention. [0172] The chimeric protein of the invention can be synthesized in a transgenic animal, such as a rodent, cow, pig, sheep, or goat. The term "transgenic animals" refers to non-human animals that have incorporated a foreign gene into their genome. Because this gene is present in germline tissues, it is passed from parent to offspring. Exogenous genes are introduced into single-celled embryos (Brinster et al. 1985, Proc. Nati. Acad. Sci. USA 82:4438). Methods of producing transgenic animals are known in the art, including transgenics that produce immunoglobulin molecules (Wagner et al. 1981, Proc. Nat/. Acad. Sci. USA 78:6376; McKnight et al. 1983, Cell 34:335; Brinster et al. 1983, Nature 306:332; Ritchie et al. 1984, Nature 312:517; Baldassarre et al. 2003, Theriogenology 59:831; RobI et al. 2003, Theriogenology 59:107; Malassagne et al. 2003, Xenotransplantation 10(3):267). [0173] The chimeric protein of the invention can also be produced by a combination of synthetic chemistry and recombinant techniques. For example, the portion of an immunoglobulin constant region can be expressed recombinantly as described above. The biologically active molecule, can be produced using known chemical synthesis techniques (e.g. solid phase synthesis). [0174] The portion of an immunoglobulin constant region can be ligated to the biologically active molecule using appropriate ligation chemistry and then combined with a portion of an immunoglobulin constant region that has not been ligated to a biologically active molecule to form the chimeric protein of the invention. In one 62 embodiment, the portion of an immunoglobulin constant region is an Fc fragment. The Fc fragment can be recombinantly produced to form Cys-Fc and reacted with a biologically active molecule expressing a thioester to make a monomer-dimer hybrid. In another embodiment, an Fc-thioester is made and reacted with a biologically active molecule expressing an N terminus Cysteine (Figure 4). [0175] In one embodiment, the portion of an immunoglobulin constant region ligated to the biologically active molecule will form homodimers. The homodimers can be disrupted by exposing the homodimers to denaturing and reducing conditions (e.g. beta-mercaptoethanol and 8M urea) and then subsequently combined with a portion of an immunoglobulin constant region not linked to a biologically active molecule to form monomer-dimer hybrids. The monomer-dimer hybrids are then renatured and refolded by dialyzing into PBS and isolated, e.g., by size exclusion or affinity chromatography. [0176] In another embodiment, the portion of an immunoglobulin constant region will form homodimers before being linked to a biologically active molecule. In this embodiment, reaction conditions for linking the biologically active molecule to the homodimer can be adjusted such that linkage of the biologically active molecule to only one chain of the homodimer is favored (e.g. by adjusting the molar equivalents of each reactant). [0177] The biologically active molecule can be chemically synthesized with an N terminal cysteine. The sequence encoding a portion of an immunoglobulin constant region can be sub-cloned into a vector encoding intein linked to a chitin binding domain (New England Biolabs, Beverly, MA). The intein can be linked to the C terminus of the portion of an immunoglobulin constant region. In one 63 embodiment, the portion of the immunoglobulin with the intein linked to its C terminus can be expressed in a prokaryotic cell. In another embodiment, the portion of the immunoglobulin with the intein linked to its C terminus can be expressed in a eukaryotic cell. The portion of immunoglobulin constant region linked to intein can be reacted with MESNA. In one embodiment, the portion of an immunoglobulin constant region linked to intein is bound to a column, e.g., a chitin column and then eluted with MESNA. The biologically active molecule and portion of an immunoglobulin can be reacted together such that nucleophilic rearrangement occurs and the biologically active molecule is covalently linked to the portion of an immunoglobulin via an amide bond. (Dawsen et al. 2000, Annu. Rev. Biochem. 69:923). The chimeric protein synthesized this way can optionally include a linker peptide between the portion of an immunoglobulin and the biologically active molecule. The linker can for example be synthesized on the N terminus of the biologically active molecule. Linkers can include peptides and/or organic molecules (e.g. polyethylene glycol and/or short amino acid sequences). This combined recombinant and chemical synthesis allows for the rapid screening of biologically active molecules and linkers to optimize desired properties of the chimeric protein of the invention, e.g., viral inhibition, hemostasis, production of red blood cells, biological half-life, stability, binding to serum proteins or some other property of the chimeric protein. The method also allows for the incorporation of non-natural amino acids into the chimeric protein of the invention which may be useful for optimizing a desired property of the chimeric protein of the invention. If desired, the chimeric protein produced by this method can be refolded to a biologically active 64 conformation using conditions known in the art, e.g., reducing conditions and then dialyzed slowly into PBS. [0178} Alternatively, the N-terminal cysteine can be on the portion of an immunoglobulin constant region, e.g., an Fc fragment. An Fc fragment can be generated with an N- terminal cysteine by taking advantage of the fact that a native Fc has a cysteine at position 226 (see Kabat et al. 1991, Sequences of Proteins of Immunological Interest, U.S. Department of Public Health, Bethesda, MD). [01791 To expose a terminal cysteine, an Fc fragment can be recombinantly expressed. In one embodiment, the Fc fragment is expressed in a prokaryotic cell, e.g., E.coli. The sequence encoding the Fc portion beginning with Cys 226 (EU numbering) can be placed immediately following a sequence endcoding a signal peptide, e.g., OmpA, PhoA, STII. The prokaryotic cell can be osmotically shocked to release the recombinant Fc fragment. In another embodiment, the Fc fragment is produced in a eukaryotic cell, e.g., a CHO cell, a BHK cell. The sequence encoding the Fc portion fragment can be placed directly following a sequence encoding a signal peptide, e.g., mouse IgK light chain or MHC class) Kb signal sequence, such that when the recombinant chimeric protein is synthesized by a eukaryotic cell, the signal sequence will be cleaved, leaving an N terminal cysteine which can than be isolated and chemically reacted with a molecule bearing a thioester (e.g. a C terminal thioester if the molecule is comprised of amino acids). [01801 The N terminal cysteine on an Fc fragment can also be generated using an enzyme that cleaves its substrate at its N terminus, e.g., Factor Xa, enterokinase, and the product isolated and reacted with a molecule with a thioester. 65 [0181] The recombinantly expressed Fc fragment can be used to make homodimers or monomer-dimer hybrids. [0182] In a specific embodiment, an Fc fragment is expressed with the human a interferon signal peptide adjacent to the Cys at position 226. When a construct encoding this polypeptide is expressed in CHO cells, the CHO cells cleave the signal peptide at two distinct positions (at Cys 226 and at Val within the signal peptide 2 amino acids upstream in the N terminus direction), This generates a mixture of two species of Fc fragments (one with an N-terminal Val and one with an N-terminal Cys). This in turn results in a mixture of dimeric species (homodimers with terminal Val, homodimers with terminal Cys and heterodimers where one chain has a terminal Cys and the other chain has a terminal Val). The Fc fragments can be reacted with a biologically active molecule having a C terminal thioester and the resulting monomer-dimer hybrid can be isolated from the mixture (e.g. by size exclusion chromatography). It is contemplated that when other signal peptide sequences are used for expression of Fc fragments in CHO cells a mixture of species of Fc fragments with at least two different N termini will be generated. [0183] In another embodiment, a recombinantly produced Cys-Fc can form a homodimer. The homodimer can be reacted with peptide that has a branched linker on the C terminus, wherein the branched linker has two C terminal thioesters that can be reacted with the Cys-Fc. In another embodiment, the biologically active molecule has a single non-terminal thioester that can be reacted with Cys-Fc. Alternatively, the branched linker can have two C terminal cysteines that can be reacted with an Fc thioester. In another embodiment, the branched linker has two functional groups that can be reacted with the Fc thioester, e.g., 2-mercaptoamine. 66 The biologically active molecule may be comprised of amino acids. The biologically active molecule may include a small organic molecule or a small inorganic molecule. F. Methods of Using Chimeric Proteins [01841 The chimeric proteins of the invention have many uses as will be recognized by one skilled in the art, including, but not limited to methods of treating a subject with a disease or condition. The disease or condition can include, but is not limited to, a viral infection, a hemostatic disorder, anemia, cancer, leukemia, an inflammatory condition or an autoimmune disease (e.g. arthritis, psoriasis, lupus erythematosus, multiple sclerosis), or a bacterial infection (see, e.g., U.S. Patent Nos. 6,086,875, 6,030,613, 6,485,726; WO 03/077834; US2003-0235536A1). 1., Methods of Treating a Subject with a Red Blood Cell Deficiency [0185] The invention relates to a method of treating a subject having a deficiency of red blood cells, e.g., anemia, comprising administering a therapeutically effective amount of at least one chimeric protein, wherein the chimeric protein comprises a first and a second polypeptide chain, wherein the first chain comprises at least a portion of an immunoglobulin constant region and at least one agent capable of inducing proliferation of red blood cells, e.g., EPO, and the second polypeptide chain comprises at least a portion of an immunoglobulin without the agent capable of inducing red blood cell proliferation of the first chain. 2. Methods of Treating a Subject with a Viral Infection [01861 The invention relates to a method of treating a subject having a viral infection or exposed to a virus comprising administering a therapeutically effective amount of at least one chimeric protein, wherein the chimeric protein comprises a 67 first and a second polypeptide chain, wherein the first chain comprises at least a portion of an immunoglobulin constant region and at least one antiviral agent, e.g., a fusion inhibitor or interferon a and the second polypeptide chain comprises at least a portion of an immunoglobulin without the antiviral agent of the first chain. In one embodiment, the subject is infected with a virus which can be treated with IFNa, e.g., hepatitis C virus. In one embodiment, the subject is infected with HIV, such as HIV 1 nr HIV- [0187] In one embodiment, the chimeric protein of the invention inhibits viral replication. In one embodiment, the chimeric protein of the invention prevents or inhibits viral entry into target cells, thereby stopping, preventing, or limiting the spread of a viral infection in a subject and decreasing the viral burden in an infected subject. By linking a portion of an immunoglobulin to a viral fusion inhibitor the invention provides a chimeric protein with viral fusion inhibitory activity with greater stability and greater bioavailability compared to viral fusion inhibitors alone, e.g., T20, T21, T1249. Thus, in one embodiment, the viral fusion inhibitor decreases or. prevents HIV infection of a target cell, e.g., HIV-1. a. Conditions That May Be Treated [0188] The chimeric protein of the invention can be used to inhibit or prevent the infection of a target cell by a hepatitis virus, e.g., hepatitis virus C. The chimeric protein may comprise an anti-viral agent which inhibits viral replication. [0189] In one embodiment, the chimeric protein of the invention comprises a fusion inhibitor. The chimeric protein of the invention can be used to inhibit or prevent the infection of any target cell by any virus (see, e.g., U.S. Patent Nos. 6,086,875, 6,030,613, 6,485,726; WO 03/077834; US2003-0235536A1). In one 68 embodiment, the virus is an enveloped virus such as, but not limited to HIV, SIV, measles, influenza, Epstein-Barr virus, respiratory syncytia virus, or parainfluenza virus. In another embodiment, the virus is a non-enveloped virus such as rhino virus or polio virus [01901 The chimeric protein of the invention can be used to treat a subject already infected with a virus. The subject can be acutely infected with a virus. Alternatively, the subject can be chronically infected with a virus. The chimeric protein of the invention can also be used to prophylactically treat a subject at risk for contracting a viral infection, e.g., a subject known or believed to-in close contact with a virus or subject believed to be infected or carrying a virus. The chimeric protein of the invention can be used to treat a subject who may have been exposed to a virus, but who has not yet been positively diagnosed. [0191] In one embodiment, the invention relates to a method of treating a subject infected with HCV comprising administering to the subject a therapeutically effective amount of a chimeric protein, wherein the chimeric protein comprises an Fc fragment of an IgG and a cytokine, e.g., IFNa. [0192] In one embodiment, the invention relates to a method of treating a subject infected with HIV comprising administering to the subject a therapeutically effective amount of a chimeric protein wherein the chimeric protein comprises an Fc fragment of an igG and the viral fusion inhibitor comprises T20. 3. Methods of Treating a Subject Having a Hemostatic Disorder [01931 The invention relates to a method of treating a subject having a hemostatic disorder comprising administering a therapeutically effective amount of at least one chimeric protein, wherein the chimeric protein comprises a first and a 69 second chain, wherein the first chain comprises at least one clotting factor and at least a portion of an immunoglobulin constant region, and the second chain comprises at least a portion of an immunoglobulin constant region. [0194] The chimeric protein of the invention treats or prevents a hemostatic disorder by promoting the formation of a fibrin clot. The chimeric protein of the invention can activate any member of a coagulation cascade. The clotting factor can be a participant in the extrinsic pathway, the intrinsic pathway or both. In one embodiment, the clotting factor is Factor VII or Factor Vila. Factor Vila can activate Factor X which interacts with Factor Va to cleave prothrombin to thrombin, which in turn cleaves fibrinogen to fibrin. In another embodiment, the clotting factor is Factor IX or Factor IXa. In yet another embodiment, the clotting factor is Factor Vil or Factor Villa. In yet another embodiment, the clotting factor is von Willebrand Factor, Factor X1, Factor XII, Factor V, Factor X or Factor XIII. a. Conditions That May Be Treated [0195] The chimeric protein of the invention can be used to treat any hemostatic disorder. The'hemostatic disorders that may be treated by administration of the chimeric protein of the invention include, but are not limited to, hemophilia A, hemophilia B, von Willebrand's disease, Factor XI deficiency (PTA deficiency), Factor XII deficiency, as well as deficiencies or structural abnormalities in fibrinogen, prothrombin, Factor V, Factor VII, Factor X, or Factor X111. [0196] In one embodiment, the hemostatic disorder is an inherited disorder. In one embodiment, the subject has hemophilia A, and the chimeric protein comprises Factor Vill or Factor Villa. In another embodiment, the subject has hemophilia A and the chimeric protein comprises Factor VII or Factor Vila. In 70 another embodiment, the subject has hemophilia B and the chimeric protein comprises Factor IX or Factor IXa. In another embodiment, the subject has hemophilia B and the chimeric protein comprises Factor VII or Factor Vila. In another embodiment, the subject has inhibitory antibodies to Factor Vill or Factor Villa and the chimeric protein comprises Factor VI1 or Factor Vila. In yet another embodiment, the subject has inhibitory antibodies against Factor IX or Factor IXa and the chimeric protein comprises Factor VIl or Factor Vila. [0197] The chimeric protein of the invention can be used to prophylactically treat a subject with a hemostatic disorder. The chimeric protein- of the invention can be- used to treat an acute bleeding episode in a subject with a hemostatic disorder [01981 In one embodiment, the hemostatic disorder is the result of a deficiency in a clotting factor, e.g., Factor IX, Factor Vill. In another embodiment, the hemostatic disorder can be the result of a defective clotting factor, e.g., von Willebrand's Factor. [01991 In another embodiment, the hemostatic disorder can be an acquired disorder. The acquired disorder can result from an underlying secondary disease or condition. The unrelated condition can be, as an example, but not as a limitation, cancer, an autoimmune disease, or pregnancy. The acquired disorder can result from old age or from medication to treat an underlying secondary disorder (e.g. cancer chemotherapy). 4. Methods of Treating a Subject In Need of a General Hemostatic Agent [0200] The invention also relates to methods of treating a subject that does not have a hemostatic disorder or a secondary disease or condition resulting in 71 acquisition of a hemostatic disorder. The invention thus relates to a method of treating a subject in need of a general hemostatic agent comprising administering a therapeutically effective amount of at least one chimeric protein, wherein the chimeric protein comprises a first and a second polypeptide chain wherein the first polypeptide chain comprises at least a portion of an immunoglobulin constant region and at least one clotting factor and the second chain comprises at least a portion of an immunoginhiudin constant region without the clotting factor of the first polypeptide chain. a. Conditions That May Be Treated [02011 In one embodiment, the subject in need of a general hemostatic agent is undergoing, or is about to undergo, surgery. The chimeric protein of the invention can be administered prior to or after surgery as a prophylactic. The chimeric protein of the invention can be administered during or after surgery to control an acute bleeding episode. The surgery can include, but is not limited to, liver transplantation, liver resection, or stem cell transplantation. [0202] The chimeric protein of the invention can be used to treat a subject having an acute bleeding episode who does not have a hemostatic disorder. The acute bleeding episode can result from severe trauma, e.g., surgery, an automobile accident, wound, laceration gun shot, or any other traumatic event resulting in uncontrolled bleeding. 5. Treatment Modalities [0203] The chimeric protein of the invention can be administered intravenously, subcutaneously, intra-muscularly, or via any mucosal surface, e.g., 72 orally, sublingually, buccally, sublingually, nasally, rectally, vaginally or via pulmonary route. The chimeric protein can be implanted within or linked to a biopolymer solid support that allows for the slow release of the chimeric protein to the desired site. [0204] The dose of the chimeric protein of the invention will vary depending on the subject and upon the particular route of administration used. Dosages can range from 0.1 to 100,000 pg/kg body weight. In one embodiment,.the dosing range is 0.1-1,000 pg/kg. The protein can be administered continuously or at specific timed intervals. In vitro assays may be employed to determine optimal dose ranges and/or schedules for administration. Many in vitro assays that measure viral infectivity are known in the art. For example, a reverse transcriptase assay, or an rt PCR assay or branched DNA assay can be used to measure HIV concentrations. A StaClot assay can be used to measure clotting activity. Additionally, effective doses may be extrapolated from dose-response curves obtained from animal models. [0205] The invention also relates to a pharmaceutical composition comprising a viral fusion inhibitor, at least a portion of an immunoglobulin and a pharmaceutically acceptable carrier or excipient. Examples of suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E.W. Martin. Examples of excipients can include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. The composition can also contain pH buffering reagents, and wetting or emulsifying agents. 73 [0206] For oral administration, the pharmaceutical composition can take the form of tablets or capsules prepared by conventional means. The composition can also be prepared as a liquid for example a syrup or a suspension. The liquid can include suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible fats), emulsifying agents (lecithin or acacia), non-aqueous vehicles (e.g. almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils), and preservatives (e.g. methyl or propyl -p-hydroxybenzoates or sorbic acid). The preparations can also include flavoring, coloring and sweetening agents. Alternatively, the composition can be presented as a dry product for constitution with water or another suitable vehicle. [0207] For buccal and sublingual administration the composition may take the form of tablets, lozenges or fast dissolving films according to conventional protocols. [0208] For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer (e.g. in PBS), with a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoromethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. [0209] The pharmaceutical composition can be formulated for parenteral administration (i.e. intravenous or intramuscular) by bolus injection. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multidose 74 containers with an added preservative. The compositions can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., pyrogen free water. [02101 The pharmaceutical composition can also be formulated for rectal administration as a suppository or retention enema, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. 6. Combination Therapy [0211] The chimeric protein of the invention can be used to treat a subject with a disease or condition in combination with at least one other known agent to treat said disease or condition. [0212] In one embodiment, the invention relates to a method of treating a subject infected with HIV comprising administering a therapeutically effective amount of at least one chimeric protein comprising a first and a second chain, wherein the first chain comprises an HIV fusion inhibitor and at least a portion of an immunoglobulin constant region and the second chain comprises at least a portion of an immunoglobulin without an HIV fusion inhibitor of the first chain, in combination with at least one other anti-HIV agent. Said other anti-HIV agent can be any therapeutic with demonstrated anti-HIV activity. Said other anti-HIV agent can include, as an example, but not as a limitation, a protease inhibitor (e.g. Amprenavir*, Crixivan*, Ritonivir*), a reverse transcriptase nucleoside analog (e.g. AZT, DDI, D4T, 3TC, Ziagen*), a nonnucleoside analog reverse transcriptase inhibitor (e.g. Sustiva®), another HIV fusion inhibitor, a neutralizing antibody specific 75 to HIV, an antibody specific to CD4, a CD4 mimic, e.g., CD4-IgG2 fusion protein (U.S. Patent Application 09/912,824) or an antibody specific to CCR5, or CXCR4, or a specific binding partner of CCR5, or CXCR4. [0213] In another embodiment, the invention relates to a method of treating a subject with a hemostatic disorder comprising administering a therapeutically effective amount of at least one chimeric protein comprising a first and a second chain, wherein the first chain comprises at least one clotting factor and at least a portion of an immunoglobulin constant region and the second chain comprises at least a portion of an immunoglobulin constant region without the clotting factor of the first chain, in combination with at least one other clotting factor or agent that promotes hemostasis. Said other clotting factor or agent that promotes hemostasis can be any therapeutic with demonstrated clotting activity. As an example, but not as a limitation, the clotting factor or hemostatic agent can include Factor V, Factor VII, Factor Vill, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII, prothrombin, or fibrinogen or activated forms of any of the preceding. The clotting factor of hemostatic agent can also include anti-fibrinolytic drugs, e.g., epsilon-amino-caproic acid, tranexamic acid. 7. Methods of Inhibiting Viral Fusion With a Target Cell [0214] The invention also relates to an in vitro method of inhibiting HIV fusion with a mammalian cell comprising combining the mammalian cell with at least one chimeric protein, wherein the chimeric protein comprises a first and a second chain, wherein the first chain comprises at least a portion of an immunoglobulin constant region and an HIV inhibitor and the second chain comprises at least a portion of an immunoglobulin constant region without the HIV inhibitor of the first chain. The 76 mammalian cell can include any cell or cell line susceptible to infection by HIV including but not limited to primary human CD4* T cells or macrophages, MOLT-4 cells, CEM cells, AA5 cells or HeLa cells which express CD4 on the cell surface. G. Methods of Isolating Chimeric Proteins [0215] Typically, when chimeric proteins of the invention are produced they are contained in a mixture of other molecules such as other proteins or protein fragments. The invention thus provides for methods of isolating any of the chimeric proteins described supra from a-mixture containing the chimeric proteins. It has been determined that the chimeric proteins of the invention bind to dye ligands under suitable conditions and that altering those conditions subsequent to binding can disrupt the bond between the dye ligand and the chimeric protein, thereby providing a method of isolating the chimeric protein. In some embodiments the mixture may comprise a monomer-dimer hybrid, a dimer and at least a portion of an immunoglobulin constant region, e.g., an Fc. Thus, in one embodiment, the invention provides a method of isolating a monomer-dimer hybrid. In another embodiment, the invention provides a method of isolating a dimer. [02161 Accordingly, in one embodiment, the invention provides a method of isolating a monomer-dimer hybrid from a mixture, where the mixture comprises a) the monomer-dimer hybrid comprising a first and second polypeptide chain, wherein the first chain comprises a biologically active molecule, and at least a portion of an immunoglobulin constant region and wherein the second chain comprises at least a portion of an immunoglobulin constant region without a biologically active molecule or immunoglobulin variable region; 77 b) a dimer comprising a first and second polypeptide chain, wherein the first and second chains both comprise a biologically active molecule, and at least a portion of an immunoglobulin constant region; and c) a portion of an immunoglobulin constant region; said method comprising 1) contacting the mixture with a dye ligand linked to a solid support under suitable conditions such that both the monomer-dimer hybrid and the dimer *bind to the dye ligand; 2) removing the unbound portion of an immunoglobulin constant region; 3) altering the suitable conditions of 1) such that the binding between the monomer-dimer hybrid and the dye ligand linked to the solid support is disrupted; 4) isolating the monomer-dimer hybrid. In some embodiments, prior to contacting the mixture with a dye ligand, the mixture may be contacted with a chromatographic substance such as protein A sepharose or the like. The mixture is eluted from the chromatographic substance using an appropriate elution buffer (e.g. a low pH buffer) and the eluate containing the mixture is then contacted with the dye ligand. [0217) Suitable conditions for contacting the mixture with the dye ligand may include a buffer to maintain the mixture at an appropriate pH. An appropriate pH may include a pH of from, 3-10, 4-9, 5-8. In one embodiment, the appropriate pH is 8.0. Any buffering agent known in the art may be used so long as it maintains the pH in the appropriate range, e.g., tris, HEPES, PIPES, MOPS. Suitable conditions may also include a wash buffer to elute unbound species from the dye ligand. The 78 wash buffer may be any buffer which does not disrupt binding of a bound species. For example, the wash buffer can be the same buffer used in the contacting step. [0218] Once the chimeric protein is bound to the dye ligand, the chimeric protein is isolated by altering the suitable conditions. Altering the suitable conditions may include the addition of a salt to the buffer. Any salt may be used, e.g., NaCl, KCI. The salt should be added at a concentration that is high enough to disrupt the binding between the dye ligand and the desired species, e.g., a monomer-dimer hybrid. [0219] In some embodiments where the mixture is comprised of an Fc, a monomer-dimer hybrid, and a dimer, it has been found that the Fc does not bind to the dye ligand and thus elutes with the flow through. The dimer binds more tightly to the dye ligand than the monomer-dimer hybrid. Thus a higher concentration of salt is required to disrupt the bond (e.g. elute) between the dimer and the dye ligand compared to the salt concentration required to disrupt the bond between the dye ligand and the monomer-dimer hybrid. [0220] In some embodiments NaCl may be used.to isolate the monomer dimer hybrid from the mixture. In some embodiments the appropriate concentration of salt which disrupts the bond between the dye ligand and the monomer-dimer hybrid is from 200-700 mM, 300-600 mM, 400-500 mM. In one embodiment, the concentration of NaCI required to disrupt the binding between the dye ligand the monomer-dimer hybrid is 400 mM. [02211 NaCl may also be used to isolate the dimer from the mixture. Typically, the monomer-dimer hybrid is isolated from the mixture before the dimer. The dimer is isolated by adding an appropriate concentration of salt to the buffer, 79 thereby disrupting the binding between the dye ligand and the dimer. In some embodiments the appropriate concentration of salt which disrupts the bond between the dye ligand and the dimer is from 800 mM to 2 M, 900 mM tol.5 M, 950 mM to 1.2 M. In one specific embodiment, 1 M NaCl is used to disrupt the binding between the dye ligand and the dimer, [0222] The dye ligand may be a bio-mimetic. A bio-mimetic is a human-made substance, device, or system that imitates nature. Thus in some embodiments the dye ligand imitates a molecule's naturally occurring ligand. The dye ligand may be chosen from Mimetic Red 11", Mimetic Red 2Tm, Mimetic Orange 1 TM, Mimetic Orange 2 Tm, Mimetic Orange 3'M, Mimetic Yellow 1Im, Mimetic Yellow 2TM, Mimetic Green 1 TM, Mimetic Blue 1 Tm, and Mimetic Blue 2 T" (Prometic Biosciences (USA) Inc., Wayne, NJ). In one specific embodiment, the dye ligand is Mimetic Red 2TM (Prometic Biosciences (USA) Inc., Wayne, NJ). In certain embodiments the dye ligand is linked to a solid support, e.g., from Mimetic Red 1A6XLTM, Mimetic Red 2 A6XL Tm, Mimetic Orange 1 A6XL TM, Mimetic Orange 2 A6XL
T
', Mimetic Orange 3 A6XLTM, Mimetic Yellow 1 A6XL
T
m, Mimetic Yellow 2 A6XL TM, Mimetic Green 1 A6XL TM, Mimetic Blue 1 A6XLTm, and Mimetic Blue 2 A6XLTm (Prometic Biosciences (USA) Inc., Wayne, NJ). [0223] The dye ligand may be linked to a solid support. The solid support may be any solid support known in the art (see, e.g., www.seperationsNOW.com). Examples of solid supports may include a bead, a gel, a membrane, a nanoparticle, or a microsphere. The solid support may comprise any material which can be linked to a dye ligand (e.g. agarose, polystyrene, sepharose, sephadex). Solid supports may comprise any synthetic organic polymer such as polyacrylic, vinyl polymers, 80 acrylate, polymethacrylate, and polyacrylamide. Solid supports may also comprise a carbohydrate polymer, e.g., agarose, cellulose, or dextran. Solid supports may comprise inorganic oxides, such as silica, zirconia, titania, ceria, alumina, magnesia (i.e., magnesium oxide), or calcium oxide. Solid supports may also comprise combinations of some of the above-mentioned supports including, but not limited to, dextran-acrylamide. Examples Example 1: Molecular Weight Affects FcRn Mediated Trancytosis [0224] Chimeric proteins comprised of various proteins of interest and IgG Fc were recombinantly produced (Sambrook et al. Molecular Cloning: A Laboratory Manual, 2 ed., Cold Spring Harbor Laboratory Press, (1989)) or in the case of contactin-Fc, MAB-p-gal, (a complex of a monoclonal antibody bound to 1-gal) (Biodesign International, Saco, ME) and MAB-GH (a complex of monoclonal antibody and growth hormone)(Research Diagnostics, Inc. Flanders, NJ) were purchased commercially. Briefly, the genes encoding the protein of interest were cloned by PCR, and then sub-cloned into an Fc fusion expression plasmid. The plasmids were transfected into DG44 CHO cells and stable transfectants were selected and amplified with methotrexate. The chimeric protein homodimers were purified over a protein A column. The proteins tested included interferon a, growth hormone, erythropoietin, follicle stimulating hormone, Factor IX, beta-galactosidase, contactin, and Factor VIII. Linking the proteins to immunoglobulin portions, including the FcRn receptor binding partner, or using commercially available whole antibody (including the FcRn binding region)-antigen complexes permitted the investigation of 81 transcytosis as a function of molecular weight (see U.S. Patent No. 6,030,613). The chimeric proteins were administered to rats orally and serum levels were measured 2-4 hours post administration using an ELISA for recombinantly produced chimeric proteins and both a western blot and ELISA for commercially obtained antibody complexes and chimeric proteins. Additionally, all of the commercially obtained proteins or complexes as well as Factor Vill-Fc, Factor IX-Fc and Epo-Fc controls were iodinated using IODO beads (Pierce, Pittsburgh, PA). The results indicated serum levels of Fc and monoclonal antibody chimeric proteins orally administered to rats are directly related to the size of the protein. The apparent cutoff point for orally administered Fc chimeric proteins is between 200-285 kD. (Table 2). TABLE 2 Protein Size (k) Transcytosis IFNa-Fc 92 ++++ GH-Fc 96 +++ Epo-Fc 120 +++ FSH-Fc 170 +++ MAB:GH 172-194 FIX-Fc 200 + MAB:pGal 285-420 Contactin-Fc 300 FVIIIA-Fc 380 Example 2: Cloning of pcDNA 3.1-Flaq-Fc [0225] The sequence for the FLAG peptide (Asp-Tyr-Lys-Asp-Asp-Asp-Asp Lys; SEQ ID NO: 91), a common affinity tag used to identify or purify proteins, was cloned into the pcDNA 3.1-Fc plasmid, which contains the mouse IgK signal sequence followed by the Fc fragment of human IgG1 (amino acids 221-447, EU numbering). The construct was created by overlapping PCR using the following primers: 82 FlagFc-F1: 5'- GCTGGCTAGCCACCATGGA -3'(SEQ ID NO:41) FlagFc-R1: 5'- CTTGTCATCGTCGTCCTTGTAGTCGTCA CCAGTGGAACCTGGAAC -3' (SEQ ID NO:42) FlagFc-F2: 5'- GACTACAAGG ACGACGATGA CAAGGACAAA ACTCACACAT GCCCACCGTG CCCAGCTCCG GAACTCC -3' (SEQ ID NO:43) FlagFc-R2: 5'- TAGTGGATCCTCATTTACCCG -3' (SEQ ID NO:44) [02261 The pcDNA 3.1-Fc template. was then added to two separate PCR reactions containing 50 pmol each of the primer pairs FlagFc-F1/R1 or FlagFc-F2/R2 in a 50 pl reaction using Pfu Ultra DNA polymerase (Stratagene, CA) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 95 0 C 2 minutes; 30 cycles of (95*C 30 seconds, 520C 30 seconds, 720C 45 seconds), followed by 721C for 10 minutes. The products of these two reactions were then mixed in another PCR reaction (2 pl each) with 50 pmol of FlagFc-F1 and FlagFc-R2 primers in a 50 pl reaction using Pfu Ultra DNA polymerase (Stratagene, CA) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 954C 2 minutes; 30 cycles of (954C 30 seconds, 520C 30 seconds, 720C 45 seconds), followed by 720C for 10 minutes. The resulting fragment was gel purified, digested and inserted into the pcDNA 3.1-Fc plasmid Nhel-Bam HI. The resulting plasmid contains contains the mouse IgK signal sequence producing the FlagFc protein. Example 3: Cloning of -Factor VIl-Fc construct [0227] The coding sequence for Factor VII, was obtained by RT-PCR from human fetal liver RNA (Clontech, Palo Alto, CA). The cloned region is comprised of the cDNA sequence from bp 36 to bp 1430 terminating just before the stop codon. A 83 Sbfl site was introduced on the N-terminus. A BspEl site was introduced on the C terminus. The construct was cloned by PCR using the primers: Downstream: 5' GCTACCTGCAGGCCACCATGGTCTCCCAGGCCCTCAGG 3'(SEQ ID NO:45) Upstream: 5' CAGTTCCGGAGCTGGGCACGGCGGGCACGTGTGAGTTT TGTCGGGAAAT GG 3' (SEQ ID NO:46) and the following conditions: 950C for 5 minutes followed by 30 cycles of 95*C for 30 seconds, 550C for 30 seconds, 72*C for 1 minute and 45 seconds, and a final extension cycle of 724C for 10 minutes. [0228] The fragment was digested Sbfl - BspE I and inserted into pED.dC-Fc a plasmid encoding for the Fc fragment of an IgG 1. Example 4: Cloning of Factor IX-Fc construct [0229] The human Factor IX coding sequence, including the prepropeptide sequence, was obtained by RT-PCR amplification from adult human liver RNA using the following primers: natFIX-F: 5'-TTACTGCAGAAGGTTATGCAGCGCGTGAACATG- 3'(SEQ ID NO:47) F9-R: 5'-Ti TTCGAATTCAGTGAGCTTTGTTTTTTCCTTAATCC- 3'(SEQ ID NO:48) [0230] 20 ng of adult human liver RNA (Clontech, Palo Alto, CA) and 25 pmol each primer were added to a RT-PCR reaction using the SuperScript.T" One-Step RT-PCR with PLATINUM@ Taq system (Invitrogen, Carlsbad, CA) according to manufacturers protocol. Reaction was carried out in a MJ Thermocycler using the following cycles: 500C 30 minutes; 940C 2 minutes; 35 cycles of (944C 30 seconds, 580C 30 seconds, 720C 1 minute), and a final 72*C 10 minutes. The fragment was 84 gel purified using Qiagen Gel Extraction Kit (Qiagen, Valencia, CA), and digested with Pstl-EcoRl, gel purified, and cloned into the corresponding digest of the pED.dC.XFc plasmid. Example 5: Cloning of PACE construct [0231] The coding sequence for human PACE (paired basic amino acid cleaving enzyme), an endoprotease, was obtained by RT-PCR. The following primers were used: PACE-Fl: 5'- GGTAAGCTTGCCATGGAGCTGAGGCCCTGGTTGC -3'(SEQ ID NO:49) PACE-R1: 5'- GTTTTCAATCTCTAGGACCCACTCGCC -3'(SEQ ID NO:50) PACE-F2: 5'- GCCAGGCCACATGACTACTCCGC -3'(SEQ ID NO:51) PACE-R2: 5'- GGTGAATTCTCACTCAGGCAGGTGTGAGGGCAGC -3'(SEQ ID NO:52) [0232] The PACE-F1 primer adds a Hindill site to the 5' end of the PACE sequence beginning with 3 nucleotides before the start codon, while the PACE-R2 primer adds a stop codon after amino acid 715, which occurs at the end of the extracellular domain of PACE, as well as adding an EcoRi site to the 3' end of the stop codon. The PACE-R1 and -F2 primers anneal on the 3' and 5' sides of an internal BamHl site, respectively. Two RT-PCR reactions were then set up using 25 pmol each of the primer pairs of PACE-F1/Ri or PACE-F2/R2 with 20 ng of adult human liver RNA (Clontech; Palo Alto, CA) in a 50 pl RT-PCR reaction using the SuperScript.im One-Step RT-PCR with PLATINUM® Taq system (Invitrogen, Carlsbad, CA) according to manufacturers protocol. The reaction was carried out in a MJ Thermocycler using the following cycles: 50*C 30 minutes; 94 0 C 2 minutes; 30 cycles of (94 0 C 30 seconds, 58 0 C 30 seconds, 72*C 2 minutes), followed by 72 0 C 10 85 minutes. These fragments were each ligated into the vector pGEM T-Easy (Promega, Madison, WI) and sequenced fully. The F2-R2 fragment was then subcloned into pcDNA6 V5/His (Invitrogen, Carlsbad, CA) using the BamHI/EcoRl sites, and then the F1-R1 fragment was cloned into this construct using the Hindlll/BamHl sites. The final plasmid, pcDNA6-PACE, produces a soluble form of PACE (amino acids 1-715), as the transmembrane region has been deleted. The sequence of PACE in pcDNA6-PACE is essentially as described in Harrison et al. 1998, Seminars in Hematology 35:4. Example 6: Cloning of IFNa-Fc eight amino acid linker construct [0233] The human interferon (x 2b (hlFNa) coding sequence, including the signal sequence, was obtained by PCR from human genomic DNA using the following primers: IFNa-Sig-F: 5'-GCTACTGCAGCCACCATGGCCTTGACCTTTGCTTTAC 3'(SEQ ID NO:53) IFNa-EcoR-R: 5'-CGTTGAATTCTTCCTTACTTCTTAAACTTTCTTGC 3'(SEQ ID NO:54) [02341 Genomic DNA was prepared from 373MG human astrocytoma cell line, according to standard methods (Sambrook et al. 1989, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press). Briefly, approximately 2 x 10 5 cells were pelleted by centrifugation, resuspended in 100 p phosphate buffered saline pH 7.4, then mixed with an equal volume of lysis buffer (100 mM Tris pH 8.0/ 200 mM NaCl / 2% SDS / 5 mM EDTA). Proteinase K was added to a final concentration of 100 pg/ml, and the sample was digested at 37*C for 4 hours with occasional gentle mixing. The sample was then extracted twice with phenol:chloroform, the DNA precipitated by adding sodium acetate pH 7.0 to 86 100 mM and an equal volume of isopropanol, and pelleted by centrifugation for 10 min at room temperature. The supernatant was removed and the pellet was washed once with cold 70% ethanol and allowed to air dry before resuspending in TE (10 mM Tris pH 8.0 / 1 mM EDTA). [0235] 100 ng of this genomic DNA was then used in a 25 pl PCR reaction with 25 pmol of each primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 940C 2 minutes; 30 cycles of (941C 30 seconds, 50*C 30 seconds, 72*C 45 seconds), and finally 72 0 C 10 minutes. The expected sized band (-550 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia, CA), digested with Pstl/EcoRI, gel purified again, and cloned into the Pstl/EcoRI site of pED.dC.XFc, which contains an 8 amino acid linker (EFAGAAAV; SEQ ID NO: 31) followed by the Fc region of human IgG1. Example 7: Cloning of IFNaFc Alinker construct [02361 1 pg of purified pED.dC.native human IFNaFc DNA, from Example 6, was then used as a template in a 25 pl PCR reaction with 25 pmol of each primer IFNa-Sig-F and the following primer: hlFNaNoLinkFc-R: 5'CAGTTCCGGAGCTGGGCACGGCGGG CACGTGTGAGTTTTGTCTTCCTTACTTCTTAAACTTTTTGCAAGTTTG- 3'(SEQ ID NO:55) [0237] The PCR reaction was carried out using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard protocol in a RapidCycler thermocycler (Idaho Technology, Salt Lake City, UT), denaturing at 94 0 C for 2 minutes followed by 18 cycles of 95 0 C for 15 seconds, 550C 87 for 0 seconds, and 720C for 1 minute with a slope of 6, followed by 720C extension for 10 minutes. A PCR product of the correct size (-525 bp) was gel purified using a Gel Extraction kit (Qiagen; Valencia, CA), digested with the Pstl and BspEl restriction enzymes, gel purified, and subcloned into the corresponding sites of a modified pED.dC.XFc, where amino acids 231-233 of the Fc region were altered using the degeneracy of the genetic code to incorporate a BspEl site while maintaining the wild type amino acid sequence. Example 8: Cloning of IFNaFc GS15 linker construct [0238] A new backbone vector was created using the Fc found in the Alinker construct (containing BspEl and Rsrll sites in the 5' end using the degeneracy of the genetic code to maintain the amino acid sequence), using this DNA as a template for a PCR reaction with the following primers: 5' B2xGGGGS (SEQ ID NO: 86): 5' gtcaggatccggcggtggagggagcgacaaaactcacacgtgccc 3'(SEQ ID NO:56) 3' GGGGS (SEQ ID NO: 81): 5' tgacgcggccgctcatttacccggagacaggg 3'(SEQ ID NO:57) [0239] A PCR reaction was carried out with 25 pmol of each primer using Pfu Turbo enzyme (Stratagene, La Jolla, CA) according to manufacturer's standard protocol in a MJ Thermocycler using the following method: 950C 2 minutes; 30 cycles of (950C 30 seconds, 540C 30 seconds, 720C 2 minutes), 720C 10 minutes. The expected sized band (-730 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA), digested BamHlI/Notl; gel purified again, and cloned into the BamHl/Notl digested vector of pcDNA6 ID, a version of pcDNA6 with the IRES sequence and dhfr gene inserted into NotI/Xbal site. 88 [0240] 500 ng of purified pED.dC.native human IFNctFc DNA was then used as a template in a 25 pl PCR reaction with the following primers: 5' IFNa for GGGGS (SEQ ID NO: 81): 5' ccgctagcctgcaggccaccatggccttgacc 3'(SEQ ID NO:58) 3' IFNa for GGGGS (SEQ ID NO: 81): 5' ccggatccgccgccaccttccttactacgtaaac 3'(SEQ ID NO:59) [0241] A PCR reaction was carried out with 25 pmol of each primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 95"C 2 minutes; 14 cycles of (940C 30 seconds, 481C 30 seconds, 72*C 1 minute), 720C 10 minutes. The expected sized band (-600 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA), digested Nhel/BamHl, gel purified again, and cloned into the NheI/BamHI site of the pcDNA6 ID/Fc vector, above, to create an IFNa Fc fusion with a 10 amino acid Gly/Ser linker (2xGGGGS; SEQ ID NO: 86), pcDNA6 ID/IFNa-GS10-Fc. [0242] A PCR reaction was then performed using 500 ng of this pcDNA6 ID/IFNa-GS10-Fc with the following primers 5' B3XGGGGS:5'(SEQ ID NO:60) gtcaggatccggtggaggcgggtccggcggtggagggagcgacaaaactcacacgtgccc 3'(SEQ ID NO:61) fcclv-R: 5' atagaagcctttgaccaggc 3'(SEQ ID NO:62) [02431 A PCR reaction was carried out with 25 pmol of each primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 89 950C 2 minutes; 14 cycles of (940C 30 seconds, 48*C 30 seconds, 720C 1 minute), 72*C 10 minutes. The expected sized band (504 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA), digested BamHI/BspEl, the 68 bp band was gel purified, and cloned into the BamHI/BspEl site of the pcDNA6 ID/IFNc-GS10-Fc vector, above, to create an IFNa. Fc fusion with a 15 amino acid Gly/Ser linker (3Xggggs; SEQ ID NO: 60), pcDNA6 ID/IFNcx-GS15-Fc. Example 9: Cloning of a Basic Peptide Construct [0244] The hinge region of the human IgG1 Fc fragment from amino acid 21 229 (EU numbering) was replaced with a basic peptide (CCB). Four overlapping oligos were used (IDT, Coralville, IA): 1. CCB-Fc Sense 1: 5'GCC GGC GAA TTC GGT GGT GAG TAC CAG GCC CTG AAG AAG AAG GTG GCC CAG CTG AAG GCC AAG AAC CAG GCC CTG AAG AAG AAG 3'(SEQ ID NO:63) 2. CCB-Fc Sense 2: 5' GTG GCC CAG CTG AAG CAC AAG GGC GGC GGC CCC GCC CCA GAG CTC CTG GGC GGA CCG A 3'(SEQ ID NO:64) 3. CCB-Fc Anti-Sense 1: 5' CGG TCC GCC CAG GAG CTC TGG GGC GGG GCC GCC GCC CTT GTG CTT CAG CTG GGC CAC CTT CTT CTT CAG GGC CTG GTT CTT G 3'(SEQ ID NO:65) 4. CCB-Fc Anti-Sense 2: 5' GCC TTC AGC TGG GCC ACC TTC TTC TTC AGG GCC TGG TAC TCA CCA CCG AAT TCG CCG GCA 3'(SEQ ID NO:66) [02451 The oligos were reconstituted to a concentration of 50 pM with dH 2 0. 5 pl of each oligo were annealed to each other by combining in a thin walled PCR tube 90 with 2.2 pl of restriction buffer #2 (i.e. final concentration of 10 mM Tris HCI pH 7.9, 10 mM MgCl 2 , 50 mM Na Cl, 1 mM dithiothreitol) (New England Biolabs, Beverly, MA) and heated to 950C for 30 seconds and then allowed to anneal by cooling slowly for 2 hours to 25 0 C. 5 pmol of the now annealed oligos were ligated into a pGEM T-Easy vector as directed in the kit manual. (Promega, Madison WI). The ligation mixture was added to 50 p of DH5a competent E coli cells (Invitrogen, Carlsbad, CA) on ice for 2 minutes, incubated at 37*C for 5 minutes, incubated on ice for 2 minutes, and then plated on LB+100 pg/L ampicillin agar plates and placed at 370C for 14 hours. Individual bacterial colonies were picked and placed in 5 ml of LB+100 pg/L ampicillin and allowed to grow for 14 hours. The tubes were spun down at 2000xg, 4*C for 15 minutes and the vector DNA was isolated using Qiagen miniprep kit (Qiagen, Valencia, CA) as indicated in the kit manual. 2 pg of DNA was digested with NgoM IV-Rsr-ll. The fragment was gel purified by the Qiaquick method as instructed in the kit manual (Qiagen, Valencia, CA) and ligated to pED.dcEpoFc with NgoM IV/Rsr 11. The ligation was transformed into DH5a competent E. coli cells and the DNA prepared as described for the pGEM T-Easy vector. Example 10: Cloning of the erythropoietin-acidic peptide Fc construct [02461 The hinge region of the human IgG1 Fc fragment in EPO-Fc from amino acid 221-229 (EU numbering) was replaced with an acidic peptide (CCA). Four overlapping oligos were used (IDT, Coralville, IA): 1. Epo-CCA-Fc Sense 1: 5' CCG GTG ACA GGG AAT TCG GTG GTG AGT ACC AGG CCC TGG AGA AGG AGG TGG CCC AGC TGG AG 3'(SEQ ID NO:67) 91 2. Epo-CCA-Fc Sense 2: 5' GCC GAG AAC CAG GCC CTG GAG AAG GAG GTG GCC CAG CTG GAG CAC GAG GGT GGT GGT CCC GCT CCA GAG CTG CTG GGC GGA CA 3'(SEQ ID NO:68) 3. Epo-CCA-Fc Anti-Sense 1: 5' GTC CGC CCA GCA GCT CTG GAG CGG GAC CAC CAC CCT CGT GCT CCA GCT GGG CCA C 3'(SEQ ID NO:69) 4. Epo-CCA-Fc Anti-Sense 2: 5' CTC CTT CTC CAG GGC CTG GTT CTC GGC CTC CAG CTG GGC CAC CTC CTT CTC CAG GGC CTG GTA CTC ACC ACC GAA TTC CCT GTC ACC GGA 3'(SEQ ID NO:70) [0247] The oligos were reconstituted to a concentration of 50 pM with dH 2 0. 5 pl of each oligo were annealed to each other by combining in a thin walled PCR tube with 2.2 pl of restriction buffer No. 2 (New England Biolabs, Beverly, MA) and heated to 950C for 30 seconds and then allowed to cool slowly for 2 hours to 250C. 5 pmol of the now annealed oligos were ligated into a pGEM T-Easy vector as directed in the kit manual. (Promega, Madison, WI). The ligation mixture was added to 50 pl of DH5a competent E. coli cells (Invitrogen, Carlsbad, CA) on ice for 2 minutes, incubated at 370C 5 minutes, incubated on ice for 2 minutes, and then plated on LB+100 pg/L ampicillin agar plates and placed at 37*C for 14 hours. Individual bacterial colonies were picked and placed in 5 ml of LB+100 pg/L ampicillin and allowed to grow for 14 hours. The tubes were spun down at 2000xg, 4*C for 15 minutes and the vector DNA was prepared using Qiagen miniprep kit (Qiagen, Valencia, CA) as indicated in the kit manual. 2 pg of DNA was digested with Age I Rsr-lI. The fragment was gel purified by the Qiaquick method as instructed in the kit manual (Qiagen, Valencia, CA) and ligated into pED.Epo Fc.1 Age I-Rsr II. The 92 ligation was transformed into DH5a competent E. coli cells and DNA prepped as described above. Example 11: Cloning of Cys-Fc construct [0248] Using PCR and standard molecular biology techniques (Sambrook et al. 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press), a mammalian expression construct was generated such that the coding sequence for the human IFNa signal peptide was directly abutted against the coding sequence of Fc beginning at the first cysteine residue (Cys 226, EU Numbering). Upon signal peptidase cleavage and secretion from mammalian cells, an Fc protein with an N-terminal cysteine residue was thus generated. Briefly, the primers IFNa-Sig-F (IFNa-Sig-F: 5'-GCTACTGCAGCCACCATGGCCTTGACCTT TGCTTTAC-3')(SEQ ID NO:71) and Cys-Fc-R (5'-CAGTTCCGGAGCTGGGCACGGCGGA GAGCCCACAGAGCAGCTTG-3') (SEQ ID NO:72) were used in a PCR reaction to create a fragment linking the IFNx signal sequence with.the N terminus of Fc, beginning with Cys 226. 500 ng of pED.dC.native hIFNa Alinker was added to 25 pmol of each primer in a PCR reaction with Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's standard protocol. The reaction was carried out in a MJ Thermocycler using the following cycles: 94*C 2 minutes; 30 cycles of (940C 30 seconds, 50*C 30 seconds, 720C 45 seconds), and finally 724C 10 minutes. The expected sized band (-112 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA), digested with the Pstl and 93 BspEl restriction enzymes, gel purified, and subcloned into the corresponding sites pED.dC.native hlFNa Alinker to generate pED.dC.Cys-Fc (Figure 5). Example 12: Protein Expression and Preparation of Fc-MESNA [0249] The coding sequence for Fc (the constant region of human IgG1) was obtained by PCR amplification from an Fc-containing plasmid using standard conditions and reagents, following the manufacturer's recommended procedure to subclone the Fc coding sequence NdellSapl. Briefly, the primers 5'- GTGGTCATA TGGGCATTGAAGGCAGAGGCGCCGCTGCGGTCG - 3'(SEQ ID NO:73) and 5' GGTGGTTGC TCTTCCGCAAAAACCCGGAGACAGGGAGAGACTCTTCTGCG - 3' (SEQ ID NO:74)were used to amplify the Fc sequence from 500 ng of the plasmid pED.dC.Epo-Fc using Expand High Fidelity System (Boehringer Mannheim, Basel Switzerland) in a RapidCylcler thermocycler (Idaho Technology Salt Lake City, Utah), denaturing at 951C for 2 minutes followed by 18 cycles of 954C for 0 sec, 55*C for 0 sec, and 724C for 1 minute with a slope of 4, followed by 72 0 C extension for 10 minutes. The PCR product was subcloned into an intermediate cloning vector and sequenced fully, and then subcloned using the Ndel and Sapl sites in the pTWIN1 vector following standard procedures. Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989, Molecular Cloning: A Laboratory Manual, 2 nd ed.; Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. This plasmid was then transformed into BL21 (DE3) pLysS cells using standard methods. Id. A 1 liter culture of cells was grown to an absorbance reading of 0.8 AU at 37 0 C, induced with 1 mM isopropyl beta-D-1-thiogalactopyranoside, and grown overnight at 25*C. Cells were pelleted by centrifugation, lysed in 20 mM Tris 8.8/1% NP40/0.1 mM 94 phenylmethanesulfonyl fluoride/ I pg/ml Benzonase (Novagen Madison, WI), and bound to chitin beads (New England Biolabs; Beverly, MA) overnight at 4*C. Beads were then washed with several column volumes of 20 mM Tris 8.5/ 500 mM NaCIl 1 mM EDTA, and then stored at -804C. Purified Fc-MESNA was generated by eluting the protein from the beads in 20 mM Tris 8.5/ 500 mM NaCl / 1 mM EDTA / 500 mM 2-mercapto ethane sulfonic acid (MESNA), and the eluate was used directly in the coupling reaction, below. Example 13: Factor VII-Fc monomer-dimer hybrid expression and purification [0250] CHO DG-44 cells expressing Factor VII-Fc were established. CHO DG-44 cells were grown at 370C, 5% CO 2 , in MEM Alpha plus nucleoside and ribonucleosides and supplemented with 5% heat-inactivated fetal bovine serum until transfection. [0251] DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%- 60%. A total of 10 pg of DNA was used to transfect one 100 mm dish: 7.5 pg of pED.dC.FVII-Fc + 1.5 pg pcDNA3/Flag-Fc + 1 pg of pcDNA6-PACE. The cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The media was removed from transfection after 48 hours and replaced with MEM Alpha without nucleosides plus 5% dialyzed fetal bovine serum and 10 pg/ml of Blasticidin (Invitrogen, Carlsbad, CA) and 0.2 mg/mI geneticin (Invitrogen, Carlsbad, CA). After 10 days, the cells were released from the plate with 0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well as stable cell lines were established. Protein expression was subsequently amplified by the addition 25 nM methotrexate. 95 [0252] Approximately 2 x 107 cells were used to inoculate 300 ml of growth medium in a 1700 cm 2 roller bottle (Corning, Coming, NY) supplemented with 5 pg/ml of vitamin K 3 (menadione sodium bisulfite) (Sigma, St Louis, MO). The roller bottles were incubated in a 5% CO 2 at 37 0 C for 72 hours. Then the.growth medium was exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 pg/mI bovine insulin and 10 pg/ml Gentamicin) supplemented with 5 pg/L of vitamin K 3 . The production medium (conditioned medium) was collected every day for 10 days and stored at 4 0 C. Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Pooled media was first clarified using a Sartoclean glass fiber filter (3.0 pm + 0.2 pm) (Sartorious Corp. Gottingen, Germany) followed by an Acropack 500 filter (0.8 pm + 0.2 pm) (Pall Corp., East Hills, NY). The clarified media was then concentrated approximately 20 fold using Pellicon Biomax tangential flow filtration cassettes (10 kDa MWCO) (Millipore Corp., Billerica, MA). [0253] Fc chimeras were then captured from the concentrated media by passage over a Protein A-Sepharose 4 Fast Flow Column (AP Biotech, Piscataway, NJ). A 5 x 5 cm (100 ml) column was loaded with 55 mg Fc protein per ml column volume at a linear flow rate of 100 cm/hour to achieve a residence time of 3 minutes. The column was then washed with >5 column volumes of 1X DPBS to remove non-specifically bound proteins. The bound proteins were eluted with 100 mM Glycine pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1 part 1 M Tris-HCL, pH 8 to 10 parts elute fraction. [0254] To remove FLAG-Fc homodimers (that is, chimeric Fc dimers with FLAG peptide expressed as fusions with both Fc molecules) from the preparation, 96 the Protein A Sepharose 4 Fast Flow pool was passed over a Unosphere S cation exchange column (BioRad Corp., Richmond, CA). Under the operating conditions for the column, the FLAG-Fc monomer-dimer hybrid is uncharged (FLAG-Fc theoretical pl=6.19) and flows through the column while the hFVII-Fc constructs are positively charged, and thus bind to the column and elute at higher ionic strength. The Protein A Sepharose 4 Fast Flow pool was first dialyzed into 20 mM MES, 20 mM NaCl, pH 6.1. The dialyzed material was then loaded onto a 1.1 x 11 cm (9.9 ml) column at 150 cm/hour.. During the wash and elution, the flow rate was increased to 500 cm/hour. The column was washed sequentially with 8 column volumes of 20 mM MES, 20 mM NaCl, pH 6.1 and 8 column volumes of 20 mM MES, 40 mM NaCl, pH 6.1. The bound protein was eluted with 20 mM MES, 750 mM NaCl, pH 6.1. Elution fractions containing the protein peak were pooled and sterile filtered through a 0.2 pm filter disc prior to storage at -80 0 C. [02551 An anti-FLAG MAB affinity column was used to separate chimeric Fc dimers with hFVII fused to both Fc molecules from those with one FLAG peptide and one hFVIlI fusion. The Unosphere S Eluate pool was diluted 1:1 with 20 mM Tris, 50 mM NaCl, 5 mM CaC2, pH 8 and loaded onto a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. Loading was targeted to < 2.5 mg monomer-dimer hybrid /ml column volume. After loading the column was washed with 5 column volumes 20 mM Tris, 50 mM NaCl, 5 mM CaC 2 , pH 8.0, monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1 part 1 M Tris-HCI, pH 8 to 10 parts eluate fraction. Pools were stored at -80 0 C. 97 Example 14: Factor IX-Fc homodimer and monomer-dimer hybrid expression and purification [0256] CHO DG-44 cells expressing Factor IX-Fc were established. DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%- 60%. A total of 10 pg of DNA was used to transfect one 100 mm dish: for the homodimer transfection, 8 pg of pED.dC.Factor IX-Fc + 2 pg of pcDNA6-PACE was used; for the monomer-dimer hybrid transfection, 8 pg of pED.dC.Factor IX-Fc + 1 pg of pcDNA3-FlagFc +1 pg pcDNA6-PACE was used. The cells were transfected as described in the Superfect transfoction reagent manual (Qiagen, Valencia, CA). The media was removed from transfection after 48 hours and replaced with MEM Alpha without nucleosides plus 5% dialyzed fetal bovine serum and 10 pg/ml of Blasticidin (Invitrogen, Carlsbad, CA) for both transfections, while the monomer dimer hybrid transfection was also supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with 0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well as stable cell lines were established. Protein expression was subsequently amplified by the addition 10 nM or 100 nM methotrexate for the homodimer or monomer-dimer hybrid, respectively. [0257] For both cell lines, approximately 2 x 107 cells were used to inoculate 300 ml of growth medium in a 1700 cm 2 roller bottle (Corning, Corning, NY), supplemented with 5 pgIL of vitamin K 3 (menadione sodium bisulfite) (Sigma, St. Louis, MO). The roller bottles were incubated in a 5% CO 2 at 37 0 C for approximately 72 hours. The growth medium was exchanged with 300 ml serum free production medium (DMEM/F12 with 5 pg/ml bovine insulin and 10 pg/ml 98 Gentamicin), supplemented with 5 pg/L of vitamin K3. The production medium (conditioned medium) was collected everyday for 10 days and stored at 4 0 C. Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the medium was clarified using a SuporCap-1 00 (0.8/0.2 pm) filter (Pall Gelman Sciences, Ann Arbor, MI). All of the following steps were performed at 4*C. The clarified medium was applied to Protein A Sepharose, washed with 5 column volumes of.IX PBS (10 mM phosphate, pH 7.4, 2.7 mM kCl,.and 137 mM NaCl), eluted with 0.1 M glycine, pH 2.7 , and then neutralized with 1/10 volume of 1 M Tris-HCI, pH 9.0. The protein was then dialyzed into PBS. [0258] The monomer-dimer hybrid transfection protein sample was subject to further purification, as it contained a mixture of FIX-Fc:FIX-Fc homodimer, FIX Fc:Flag-Fc monomer-dimer hybrid, and Flag-Fc:Flag-Fc homodimer. Material was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade column at a flow rate of 4 ml/minute (36 cm/hour) and then eluted with 3 column volumes of 1X PBS. Fractions corresponding to two peaks on the UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained either FIX-Fc:FIX-Fc homodimer or FIX-Fc:FlagFc monomer-dimer hybrid, while the second peak contained FlagFc:FlagFc homodimer. All fractions containing the monomer-dimer hybrid but no FlagFc homodimer were pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. After loading, the column was washed with 5 column volumes PBS. Monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by 99 adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing and nonreducing SDS-PAGE. Fractions were dialyzed into PBS, concentrated to 1-5 mg/ml, and stored at -804C. Example 15: IFNa homodimer and monomer-dimer hybrid expression and purification [0259] CHO DG-44 cells expressing hlFNoc were established. DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50% 60%. A total of 10 pg of DNA was used to transfect one 100 mm dish: for the homodimer transfection, 10 pg of the hlFNaFc constructs; for the monomer-dimer hybrid transfection, 8 pg of the hlFNaFc constructs + 2 pg of pcDNA3-FlagFc. The cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The media was removed from transfection after 48 hours and replaced with MEM Alpha without nucleosides plus 5% dialyzed fetal bovine serum, while the monomer-dimer hybrid transfection was also supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with 0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well and stable cell lines were established. Protein expression was subsequently amplified by the addition methotrexate: ranging from 10 to 50 nM. [0260] For all cell lines, approximately 2 x 107 cells were used to inoculate 300 ml of growth medium in a 1700 cm 2 roller bottle (Corning, Corning, NY). The roller bottles were incubated in a 5% C02 at 370C for approximately 72 hours. Then the growth medium was exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 pg/ml bovine insulin and 10 pg/ml Gentamicin). The production 100 medium (conditioned medium) was collected every day for 10 days and stored at 40C. Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the medium was clarified using a SuporCap-1 00 (0.8/0.2 pm) filter from Pall Gelman Sciences (Ann Arbor, MI). All of the following steps were performed at 40C. The clarified medium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris HCI, pH 9.0. The protein was then dialyzed into PBS. [02611 The monomer-dimer hybrid transfection protein samples were then subject to further purification, as it contained a mixture of IFNxFc:lFNaFc homodimer, IFNaFc:FlagFc monomer-dimer hybrid, and FlagFc:FlagFc homodimer (or Alinker or GS15 linker). Material was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade column at a flow rate of 4 ml/min (36 cm/hr) and then eluted with 3 column volumes of IX PBS. Fractions corresponding to two peaks on the UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained either IFNaFc:lFNaFc homodimer or IFNaFc:FlagFc monomer-dimer hybrid, while the second peak contained FlagFc:FlagFc homodimer. All fractions containing the monomer-dimer hybrid, but no FlagFc homodimer, were pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. After loading the column was washed with 5 column volumes PBS monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing 101 and nonreducing SDS-PAGE. Fractions were dialyzed into PBS, concentrated to 1 5 mg/ml, and stored at -80*C. Example 16: Coiled coil protein expression and purification [0262] The plasmids, pED.dC Epo-CCA-Fc and pED.dC CCB-Fc will be transfected either alone or together at a 1:1 ratio into CHO DG44 cells. The cells will be transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The media will be removed after 48 hours and replaced with MEM Alpha w/o nucleosides plus 5% dialyzed fetal bovine serum. Purification will be done by affinity chromatography over a protein A column according to methods known.in the art. Alternatively, purification can be achieved using size exclusion chromatography. Example 17: Cys-Fc expression and purification [0263] CHO DG-44 cells expressing Cys-Fc were established. The pED.dC.Cys-Fc expression plasmid, which contains the mouse dihydrofolate reductase (dhfr) gene, was transfected into CHO DG44 (dhfr-deficient) cells using Superfect reagent (Qiagen; Valencia, CA) according to manufacturer's protocol, followed by selection for stable transfectants in aMEM (without nucleosides) tissue culture media supplemented with 5% dialyzed FBS and penicillin/streptomycin antibiotics (Invitrogen; Carlsbad, CA) for 10 days. The resulting pool of stably transfected cells were then amplified with 50 nM methotrexate to increase expression. Approximately 2 x 107 cells were used to inoculate 300 ml of growth medium in a 1700 cm 2 roller bottle (Corning, Corning, NY). The roller bottles were incubated in a 5% CO 2 at 37 0 C for approximately 72 hours. The growth medium 102 was exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 pg/ml bovine insulin and 10 pg/ml Gentamicin). The production medium (conditioned medium) was collected every day for 10 days and stored at 4*C. Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the medium was clarified using a SuporCap-100 (0.8/0.2 pm) filter from Pall Gelman Sciences (Ann Arbor, MI). All of the following steps were performed at 4 0 C. The clarified medium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCl), eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-HCI, pH 9.0. Protein was dialyzed into PBS and used directly in conjugation reactions. Example 18: Couplinq of T20-thioesters to Cys-Fc [0264] Cys-Fc (4 mg, 3.2 mg/ml final concentration) and either T20-thioester or T20-PEG-thioester (2 mg, approximately 5 molar equivalents) were incubated for 16 hours at room temperature in 0.1 M Tris 8/ 10 mM MESNA. Analysis by SDS PAGE (Tris-Gly gel) using reducing sample buffer indicated the presence of a new band approximately 5 kDa larger than the Fc control (>40-50% conversion to the conjugate). Previous N-terminal sequencing of Cys-Fc and unreacted Cys-Fc indicated that the signal peptide is incorrectly processed in a fraction of the molecules, leaving a mixture of (Cys)-Fc, which will react through native ligation with peptide-thioesters, and (Val)-(Gly)-(Cys)-Fc, Which will not. As the reaction conditions are insufficient to disrupt the dimerization of the Cys-Fc molecules, this reaction generated a mixture of T20-Cys-Fc:T20-Cys-Fc homodimers, T20-Cys-Fc: Fc monomer-dimer hybrids, and Cys-Fc:Cys-Fc Fc-dimers. This protein was purified 103 using size exclusion chromatography as indicated above to separate the three species. The result was confirmed by SDS-PAGE analysis under nonreducing conditions. Example 19: Antiviral assay for IFNa activity [0265] Antiviral activity (IU/ml) of IFNa fusion proteins was determined using a CPE (cytopathic effect) assay. A549 cells were plated in a 96 well tissue culture plate in growth media (RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine) for 2 hours at 370C, 5% C02. IFNa standards and IFNa fusion proteins were diluted in growth media and added to cells in triplicate for 20 hours at 370C, 5% C02. Following incubation, all media was removed from wells, encephalomyocarditis virus (EMC) virus was diluted in growth media and added (3000 pfu/well) to each well with the exception of control wells. Plates were incubated at 370C, 5% CO 2 for 28 hours. Living cells were fixed with 10% cold trichloroacetic acid (TCA) and then stained with Sulforhodamine B (SRB) according to published protocols (Rubinstein et al. 1990, J. Natl. Cancer Inst. 82, 1113). The SRB dye was solubilized with 10 mM Tris pH 10.5 and read on a spectrophotometer at 490 nm. Samples were analyzed by comparing activities to a known standard curve World Health Organization IFNax 2b International Standard ranging from 5 to 0.011 IU/ml. The results are presented below in Table 3 and Figure 6 and demonstrate increased antiviral activity of monomer-dimer hybrids. TABLE 3: INTERFERON ANTIVIRAL ASSAY HOMODIMER V. MONOMER-DIMER HYBRID Protein Antiviral Activity Std dev 1(0U/nmo) 104 IFNaFc 8aa linker homodimer 0.45 x 10' 0.29 x 10 IFNaFc 8aa linker:FlagFc 4.5 x 105 1.2 x 10' monomer-dimer hybrid IFNaFc A linker homodimer 0.22 x 105 0.07 x 10' IFNaFc A delta linker: FlagFc 2.4 x 10 0.0005 x 10 monomer-dimer hybrid IFNaFc GS15 linker 2.3x10 5 1.0x10b homodimer IFNaFc GS15 linker 5.3x10 5 0.15x10 5 monomer-dimer hybrid Example 20: FVIla Clotting Activity Analysis [0266] The StaClot FVlla-rTF assay kit was purchased from Diagnostica Stago (Parsippany, NJ) and modified as described in Johannessen et al. 2000, Blood Coagulation and Fibrinolysis 11:S159. A standard curve was preformed with the FVIla World Health Organization standard 89/688. The assay was used to compare clotting activity of monomer-dimer hybrids compared to homodimers. The results showed the monomer-dimer hybrid had four times the clotting activity compared to the homodimer (Figure 7). Example 21: FVIla-Fc Oral dosing in day 10 rats [0267] 25 gram day 9 newborn Sprague Dawley rats were purchased from Charles River (Wilmington, MA) and allowed to acclimate for 24 hours. The rats were dosed orally with FVIIaFc homodimer, monomer-dimer hybrid or a 50:50 mix of the two. A volume of 200 pl of a FVilaFc solution for a dose of 1 mg/kg was administered. The solution was composed of a Tris-HCI buffer pH 7.4 with 5 mg/mI soybean trypsin inhibitor. The rats were euthanized with C02 at several time points, and 200 pf of blood was drawn by cardiac puncture. Plasma was obtained by the addition of a 3.8% sodium citrate solution and centrifugation at room temperature at 105 a speed of 1268xg. The plasma samples were either assayed fresh or frozen at 20 0 C. Orally dosed monomer-dimer hybrid resulted in significantly higher maximum (Cmax) serum concentrations compared to homodimeric Factor VII (Figure 8). Example 22: Factor IX-Fc Oral dosing of neonatal rats [0268] Ten-day old neonatal Sprague-Dawley rats were dosed p.o. with 200 pl of FIX-Fc homodimer or FIX-Fc: FlagFc monomer-dimer hybrid at approximately equimolar doses of 10 nmol/kg in 0.1 M sodium phosphate buffer, pH 6.5 containing 5 mg/ml soybean trypsin inhibitor and 0.9% NaCI. At 1, 2, 4, 8, 24, 48, and 72 hours post injection, animals were euthanized with C02, blood was drawn via cardiac puncture and plasma was obtained by the addition of a 3.8% sodium citrate solution and centrifugation at room temperature at a speed of 1268xg. Samples were then sedimented by centrifugation, serum collected and frozen at -201C until analysis of the fusion proteins by ELISA. Example 23: Factor IX-Fc ELISA [0269] A 96-well Immulon 4HBX ELISA plate (Thermo LabSystems, Vantaa, Finland) was coated with 100 pl/well of goat anti-Factor IX IgG (Affinity Biologicals, Ancaster, Canada) diluted 1:100 in 50 mM carbonate buffer, pH 9.6. The plates were incubated at ambient temperature for 2 hours or overnight at 40C sealed with plastic film. The wells were washed 4 times with PBST, 300 pl/well using the TECAN plate washer. The wells were blocked with PBST + 6% BSA, 200 pl/well, and incubated 90 minutes at ambient temperature. The wells were washed 4 times with PBST, 300 pl/well using the TECAN plate washer. Standards and blood samples from rats described in Example 18 were added to the wells, (100 pl/well), 106 and incubated 90 minutes at ambient temperature. Samples and standards were diluted in HBET buffer (HBET: 5.95 g HEPES, 1.46 g NaCl, 0.93 g Na 2 EDTA, 2.5 g Bovine Serum Albumin, 0.25 ml Tween-20, bring up to 250 ml with dH 2 0, adjust pH to 7.2). Standard curve range was from 200 ng/ml to 0.78 ng/ml with 2 fold dilutions in between. Wells were washed 4 times with PBST, 300 pl/well using the TECAN plate washer. 100 pl/well of conjugated goat anti-human IgG-Fc-HARP antibody (Pierce, Rockford, IL) diluted in HBET 1:25,000 was added to each well. The plates were incubated 90 minutes at ambient temperature. The wells were washed 4 times with PBST, 300 pl/well using the TECAN plate washer. The plates were developed with 100 pl/well of tetramethylbenzidine peroxidase substrate (TMB) (Pierce, Rockford, IL) was added according to the manufacturer's instructions. The plates were incubated 5 minutes at ambient temperature in the dark or until color developed. The reaction was stopped with 100 pl/well of 2 M sulfuric acid. Absorbance was read at 450 nm on SpectraMax plusplate reader (Molecular Devices, Sunnyvale, CA). Analysis of blood drawn at 4 hours indicated more than a 10 fold difference in serum concentration between Factor IX-Fc monomer-dimer hybrids compared to Factor IX Fc homodimers (Figure 9). The results indicated Factor IX-Fc monomer-dimer hybrid levels were consistently higher than Factor IX Fc homodimers (Figure 10). Example 24: Cloning of Epo-Fc [0270] The mature Epo coding region was obtained by PCR amplification from a plasmid encoding the mature erythropoietin coding sequence, originally obtained by RT-PCR from Hep G2 mRNA, and primers hepoxba-F and hepoeco-R, indicated below. Primer hepoxba-F contains an Xbal site, while primer hepoeco-R contains 107 an EcoRI site. PCR was carried out in the Idaho Technology RapidCycler using Vent polymerase, denaturing at 95 0 C for 15 seconds, followed by 28 cycles with a slope of 6.0 of 950C for 0 seconds, 55 0 C for 0 seconds, and 72*C for 1 minute 20 seconds, followed by 3 minute extension at 720C. An approximately 514 bp product was gel purified, digested with Xbal and EcoRl, gel purified again and directionally subcloned into an Xbal/EcoRl-digested, gel purified pED.dC.XFc vector, mentioned above. This construct was named pED.dC.EpoFc. [0271] The Epo sequence, containing both the endogenous signal peptide and the mature sequence, was obtained by PCR amplification using an adult kidney QUICK-clone cDNA preparation as the template and primers Epo+Pep-Sbf-F and Epo+Pep-Sbf-R, described below. The primer Epo+Pep-Sbf-F contains an Sbfl site upstream of the start codon, while the primer Epo+Pep-Sbf-R anneals downstream of the endogenous Sbfl site in the Epo sequence. The PCR reaction was carried out in the PTC-200 MJ Thermocycler using Expand polymerase, denaturing at 94*C for 2 minutes, followed by 32 cycles of 94*C for 30 seconds, 570C for 30 seconds, and 720C for 45 seconds, followed by a 10 minute extension at 72*C. An approximately 603 bp product was gel isolated and subcloned into the pGEM-T Easy vector. The correct coding sequence was excised by Sbfl digestion, gel purified, and cloned into the Psti-digested, shrimp alkaline phosphatase (SAP)-treated, gel purified pED.dC.EpoFc plasmid. The plasmid with the insert in the correct orientation was initially determined by Kpnl digestion. A XmnI and Pvull digestion of this construct was compared with pED.dC.EpoFc and confirmed to be in the correct orientation. The sequence was determined and the construct was named pED.dC.natEpoFc. PCR Primers: 108 hepoxba-F (EPO-F): 5'-AATCTAGAGCCCCACCACGCCTCATCTGTGAC-3'(SEQ ID NO:75) hepoeco-R (EPO-R) 5'-TTGAATTCTCTGTCCCCTGTCCTGCAGGCC-3'(SEQ ID NO:76) Epo+Pep-Sbf-F: 5'-GTACCTGCAGGCGGAGATGGGGGTGCA-3'(SEQ ID NO:77) Epo+Pep-Sbf-R: 5'-CCTGGTCATCTGTCCCCTGTCC-3'(SEQ ID NO:78) Example 25: Cloning of Epo-Fc [0272] An alternative method of cloning EPO-Fc is described herein. Primers were first designed to amplify the full length Epo coding sequence, including the native signal sequence, as follows: Epo-F: 5'-GTCCAACCTG CAGGAAGCTTG CCGCCACCAT GGGAGTGCAC GAATGTCCTG CCTGG- 3'(SEQ ID NO:79) Epo-R: 5'-GCCGAATTCA GTTTTGTCGA CCGCAGCGG CGCCGGCGAA CTCTCTGTCC CCTGTTCTGC AGGCCTCC- 3'(SEQ ID NO:80) [02731 The forward primer incorporates an Sbfl and Hindlll site upstream of a Kozak sequence, while the reverse primer removes the internal Sbfl site, and adds an 8 amino acid linker to the 3' end of the coding sequence (EFAGAAAV) (SEQ ID NO: 31) as well as Sall and EcoRI restriction sites. The Epo coding sequence was then amplified from a kidney cDNA library (BD Biosciences Clontech, Palo Alto, CA) using 25 pmol of these primers in a 25 pl PCR reaction using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 940C 2 minutes; 30 cycles of (940C 30 seconds, 58*C 30 seconds, 72*C 45 seconds), followed by 72*C for 10 minutes. The expected sized band (641 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia, CA) and ligated into the intermediate cloning vector 109 pGEM T-Easy (Promega, Madison, WI). DNA was transformed into DH5a cells (Invitrogen, Carlsbad, CA) and miniprep cultures grown and purified with a Plasmid Miniprep Kit (Qiagen, Valencia, CA) both according to manufacturer's standard protocols. Once the sequence was confirmed, this insert was digested out with Sbfi/EcoRl restriction enzymes, gel purified, and cloned into the Pstl/EcoRI sites of the mammalian expression vector pED.dC in a similar manner. [0274] Primers were designed to amplify the coding sequence for the constant region of human IgG1 (the Fc region, EU numbering 221-447) as follows: Fc-F: 5'-GCTGCGGTCG ACAAAACTCA CACATGCCCA CCGTGCCCAG CTCCGGAACT CCTGGGCGGA CCGTCAGTC- 3'(SEQ ID NO:82) Fc-R 5'-ATTGGAATTC TCATTTACCC GGAGACAGGG AGAGGC- 3'(SEQ ID NO:83) The forward primer incorporates a Sall site at the linker-Fc junction, as well as introducing BspEl and RsrlI sites into the Fc region without affecting the coding sequence, while the reverse primer adds an EcoRI site after the stop codon. TheFc coding sequence was then amplified from a leukocyte cDNA library (BD Biosciences Clontech, Palo Alto, CA) using 25 pmol of these primers in a 25 pl PCR reaction using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 94"C 2 minutes; 30 cycles of (94 0 C 30 seconds, 58 0 C 30 seconds, 72*C 45 seconds), followed by 72*C for 10 minutes. The expected sized band (696 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia, CA) and ligated into the intermediate cloning vector pGEM T-Easy (Promega, Madison, WI). DNA was transformed into DH5a cells (Invitrogen, Carlsbad, CA) and miniprep cultures grown and purified with a Plasmid Miniprep Kit (Qiagen, Valencia, CA), both according to 110 manufacturer's standard protocols. Once the sequence was confirmed, this insert was digested out with Sal/EcoRi restriction enzymes, gel purified, and cloned into the Sall/EcoRI sites of the plasmid pED.dC.Epo (above) in a similar manner, to generate the mammalian expression plasmid pED.dC.EpoFc. In another experiment this plasmid was also digested with Rsrll/Xmal, and the corresponding fragment from pSYN-Fc-002, which contains the Asn 297 Ala mutation (EU numbering) was cloned in to create pED.dC.EPO-Fc N297A (pSYN-EPO-004). Expression in mammalian cells was as described in Example 26. The amino acid sequence of EpoFc with an eight amino acid linker is provided in figure 2j. During the process of this alternative cloning method, although the exact EpoFc amino acid sequence was preserved (figure 2J), a number of non-coding changes were made at the nucleotide level (figure 3J). These are G6A (G at nucleotide 6 changed to A) (eliminate possible secondary structure in primer), G567A (removes endogenous Sbfl site from Epo), A582G (removes EcoRI site from linker), A636T and T639G (adds unique BspEl site to Fc), and G651C (adds unique Rsril site to Fc). The nucleotide sequence in figure 3J is from the construct made in Example 25, which incorporates these differences from the sequence of the construct from Example 24. Example 26: EPO-Fc Homodimer And Monomer-dimer Hybrid Expression And Purification [0275] DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%-60%. A total of 10 pg of DNA was used to transfect one 100 mm dish: for the homodimer transfection,10 pg of pED.dC.EPO-Fc; for the monomer-dimer hybrid transfection, 8 pg of pED.dC.EPO-Fc + 2 pg of pcDNA3 FlagFc. The constructs used were cloned as described in Example 24. The cloning 111method described in Example 25 could also be used to obtain constructs for use in this example. The cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). Alternatively, pED.dC.EPO-Fc was cotransfected with pSYN-Fc-016 to make an untagged monomer. The media was removed from transfection after 48 hours and replaced with MEM Alpha without nucleosides plus 5% dialyzed fetal bovine serum for both transfections, while the monomer-dimer hybrid transfection was also supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with 0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well as stable cell lines were established. Protein expression was subsequently amplified by the addition methotrexate. [0276 For both cell lines, approximately 2 x 10 7 cells were used to inoculate 300 ml of growth medium in a 1700 cm 2 roller bottle (Corning, Corning, NY). The roller bottles were incubated in a 5% CO 2 at 37 0 C for approximately 72 hours. The growth medium was exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 pg/ml bovine insulin and 10 pg/ml Gentamicin). The production medium (conditioned medium) was collected every day for 10 days and stored at 4*C. Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the medium was clarified using a SuporCap-100 (0.8/0.2 pm) filter from Pall Gelman Sciences (Ann Arbor, MI). All of the following steps were performed at 44C. The clarified medium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCl), 112 eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris HCI, pH 9.0. Protein was then dialyzed into PBS. [0277] The monomer-dimer hybrid transfection protein sample was subject to further purification, as it contained a mixture of EPO-Fc:EPO-Fc homodimer, EPO Fc:Flag-Fc monomer-dimer hybrid, and Flag-Fc:Flag-Fc homodimer. Material was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade column at a flow rate of 4 mIl/min (36 cm/hour) and then eluted with 3 column volumes of 1X PBS. Fractions corresponding to two peaks on the UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained either EPO-Fc:EPO-Fc homodimer or EPO-Fc:FlagFc monomer-dimer hybrid, while the second peak contained FlagFc:FlagFc homodimer. All fractions containing the monomer-dimer hybrid but no FlagFc homodimer were pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp.) at a linear flow rate of 60 cm/hour. After loading the column was washed with 5 column volumes PBS. Monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0. Elution fractions containing the protein peak were then neutralized by adding 1/10 volume of 1 M Tris-HCI, and analyzed by reducing and nonreducing SDS-PAGE. Fractions were dialyzed into PBS, concentrated to 1-5 mg/mi, and stored at -80 0 C. [0278] Alternatively, fractions from first peak of the Superdex 200 were analyzed by SDS-PAGE, and only fractions containing a majority of EpoFc monomer-dimer hybrid, with a minority of EpoFc homodimer, were pooled. This pool, enriched for the monomer-dimer hybrid, was then reapplied to a Superdex 200 column, and fractions containing only EpoFc monomer-dimer hybrid were then 113 pooled, dialyzed and stored as purified protein. Note that this alternate purification method could be used to purify non-tagged monomer-dimer hybrids as well. Example 27: Administration of EpoFc Dimer and Monomer-Dimer Hybrid With an Eight Amino Acid Linker to Cynomolgus Monkeys [0279] For pulmonary administration, aerosols of either EpoFc dimer or EpoFc monomer-dimer hybrid proteins (both with the 8 amino acid linker) in PBS, pH 7.4 were created with the Aeroneb ProTm (AeroGen, Mountain View, CA) nebulizer, in line with a Bird Mark 7A respirator, and administered to anesthetized naYve cynomolgus monkeys through endotracheal tubes (approximating normal tidal breathing). Both proteins were also administered to naive cynomolgus monkeys by intravenous injection. Samples were taken at various time points, and the amount of Epo-containing protein in the resulting plasma was quantitated using the Quantikine IVD Human Epo Immunoassay (R&D Systems, Minneapolis, MN). Pharmacokinetic parameters were calculated using the software WinNonLin. Table 4 presents the bioavailability results of cynomolgus monkeys treated with EpoFc monomer-dimer hybrid or EpoFc dimer. TABLE 4: ADMINISTRATION OF EPOFC MONOMER-DIMER HYBRID AND EPOFC DIMER TO MONKEYS Approx. Protein Monkey Route Deposited Cmax Cmax t 1
/
2 t, 2 avg P Dose' (ng/ml) (fmol/ml) (hr) (hr) (pg/kg) C06181 pulm 20 72.3 1014 23.6 C06214 pulm 20 50.1 703 23.5 EpoFc C07300 pulm 20 120 1684 36.2 25.2 monomer- C07332 pulm 20 100 1403 17.5 hybrid C07285 IV 25 749 10508 21.3 C07288 IV 25 566 7941 23 22.6 C07343 IV 25 551 1014 23.5 114 DD026 pulm 15 10.7 120 11.5 DD062 pulm 15 21.8 244 27.3 DD046 pulm 15 6.4 72 21.8 22.1 DD015 pulm 15 12.8 143 20.9 EpoFc DD038 pulm 35 27 302 29 dimer F4921 IV 150 3701 41454 15.1 d 96Z002 IV 150 3680 41219 15.3 1261CQ IV 150 2726 30533 23.6 14.6 127-107 IV 150 4230 47379 15.0 118-22 IV 150 4500 50403 8.7 126-60 IV 150 3531 39550 9.8 Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy [0280] The percent bioavailability (F) was calculated for the pulmonary doses using the following equation: F= (AUC pulmonary / Dose pulmonary) / (AUC IV / Dose IV) * 100 115 TABLE 5: CALCULATION OF PERCENT BIOAVAILABILITY FOR EPOFC MONOMER-DIMER HYBRID V. DIMER AFTER PULMONARY ADMINISTRATION TO NAIVE CYNOMOLGUS MONKEYS Approx. AC Boviaiiy Avrg Protein Monkey # Dose' AUC Bioavailabiity 2 Average (deposited) ng.hrimL (F) Bioavailabiity EpoFc C06181 20 pg/kg 3810 25.2% monomer- C06214 20 pg/kg 3072 20.3% 34.9% dimer C07300 20 pg/kg 9525 63.0% hybrid C07332 20 pg/kg 4708 31.1% DD026 15 pg/kg 361 5.1% EpoFc DD062 15 pg/kg 1392 19.6% dimer DD046 15 pg/kg 267 3.8% 10.0 % DD015 15 pg/kg 647 9.1% DD038 35 pg/kg 2062 12.4% Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy 2 Mean AUC for IV EpoFc monomer-dimer hybrid = 18,913 ng-hrmL (n=3 monkeys), dosed at 25 pglkg. Mean AUC for IV EpoFc dimer = 70, 967 ng-hrimL (n=6 monkeys), dosed at 150 pglkg [0281] The pharmacokinetics of EpoFc with an 8 amino acid linker administered to cynomolgus monkeys is presented in figure 11. The figure compares the EpoFc dimer with the EpoFc monomer-dimer hybrid in monkeys after administration of a single pulmonary dose. Based on a molar comparison significantly higher serum levels were obtained in monkeys treated with the monomer-dimer hybrid compared to the dimer. Example 28: Subcutaneous Administration of EPOFc Monomer-dimer Hybrid {02821 To compare serum concentrations of known erythropoietin agents with EPOFc monomer-dimer hybrids, both EPOFc monomer-dimer hybrid and Aranesp* (darbepoetin alfa), which is not a chimeric fusion protein, were administered subcutaneously to different monkeys and the serum concentration of both was measured over time. 116 [0283] Cynomolgus monkeys (n = 3 per group) were injected subcutaneously with 0.025 mg/kg EpoFc monomer-dimer hybrid. Blood samples were collected predose and at times up to 144 hours post dose. Serum was prepared from the blood and stored frozen until analysis by ELISA (Human Epo Quantikine Immunoassay) (R & D Systems, Minneapolis, MN). Pharmacokinetic parameters were determined using WinNonLina* software (Pharsight, Mountainview, CA). [0284] The results indicated the serum concentrations of both EPOFc monomer-dimer hybrid and Aranesp* (darbepoetin alfa) were equivalent over time, even though the administered molar dose of Aranesp* (darbepoetin alfa) was slightly larger (Table 6) (figure 12). TABLE6 Route Dose Dose Cmax AUC T 2 % (gg/kg) (nmol/kg) (ng/mL) (ngehremL~') (hr) Bioavailability I (F) EpoFc Subcutaneous 25 0.3 133 10,745t 26 57± 17 Monomer- 34 3,144 5 dirner hybrid Aranesp* Subcutaneous 20 0.54 83 ± 11 5390 ±747 22 53 8 ±2 Example 29: Intravenous Administration of EPOFc Monomer-dimer Hybrid [0285] To compare serum concentrations of known erythropoietin agents with EPOFc monomer-dimer hybrids, EPOFc monomer-dimer hybrid, Aranesp* (darbepoetin alfa), and Epogen* (epoetin alfa), neither of which is a chimeric fusion protein, were administered intravenously to different monkeys and the serum concentration of both was measured over time. 117 [0286] Cynomolgus monkeys (n = 3 per group) were injected intravenously with 0.025 mg/kg EpoFc monomer-dimer hybrid. Blood samples were collected predose and at times up to 144 hours post dose. Serum was prepared from the blood and stored frozen until analysis by ELISA (Human Epo Quantikine Immunoassay) (R & D Systems, Minneapolis, MN). Pharmacokinetic parameters -were determined using WinNonLin5 software (Pharsight, Mountainview, CA). [0287] The results indicated the serum concentration versus time (AUC) of EPOFc monomer-dimer hybrid was greater than the concentrations of either Epogen* (epoetin alfa) or Aranesp* (darbepoetin alfa), even though the monkeys received larger molar doses of both Epogen* (epoetin alfa) and Aranesp* (darbepoetin alfa) (Table 7) (Figure 13). TABLE7 Route Dose Dose Cmax AUC T/ . ([tg/kg) (nmol/kg) (ng/mL) (ngehremL 1 ) (hr) EpoFc Intravenous 25 0.3 622 ± 18,913 + 23 ± 1 Monomer- 110 3,022 dimer hybrid Aranesp* Intravenous 20 0.54 521 ±8 10,219 + 20 ± 1 1 _298 Epogen Intravenous 20 0.66 514 ± 3936 ± 636 6.3 ± 0.6 1__ _ _ _172 1 1 Example 30: Alternative Purification of EpoFc Monomer-dimer Hybrid [02881 Yet another alternative for purifying EPO-Fc is described herein. A mixture containing Fc, EpoFc monomer-dimer hybrid, and EpoFc dimer was applied to a Protein A Sepharose column (Amersham, Uppsala, Sweden). The mixture was eluted according to the manufacturer's instructions. The Protein A Sepharose eluate, containing the mixture was buffer exchanged into 50 mM Tris-Cl (pH 8.0). 118 The protein mixture was loaded onto an 8 mL Mimetic Red 2 XL column (ProMetic Life Sciences, Inc., Wayne, NJ) that had been equilibrated in 50 mM Tris-Cl (pH 8.0). The column was then washed with 50 mM Tris-Cl (pH 8.0); 50 mM NaCl. This step removed the majority of the Fc. EpoFc monomer-dimer hybrid was specifically eluted from the column with 50 mM Tris-Cl (pH 8.0); 400 mM NaCl. EpoFc dimer can be eluted and the column regenerated with 5 column volumes of 1 M NaOH. Eluted fractions from the column were analyzed by SDS-PAGE (Figure 14). Example 31: Cloning of 1qK signal sequence - Fc construct for making untaged Fc alone. [02891 The coding sequence for the constant region of IgG1 (EU # 221-447; the Fc region) was obtained by PCR amplification from a leukocyte cDNA library (Clontech, CA) using the following primers: rcFc-F 5'- GCTGCGGTCGACAAAACTCACACATGCCCACCGTGCCCAGCTCC GGAACTCCTGGGCGGACCGTCAGTC -3' (SEQ ID NO: 82) rcFc-R 5'- ATTGGAATTCTCATTTACCCGGAGACAGGGAGAGGC -3' (SEQ ID NO: 83) [0290] The forward primer adds three amino acids (AAV) and a Sall cloning site before the beginning of the Fc region, and also incorporates a BspEl restriction site at amino acids 231-233 and an RsrlI restriction site at amino acids 236-238 using the degeneracy of the genetic code to preserve the correct amino acid sequence (EU numbering). The reverse primer adds an EcoRI cloning site after the stop codon of the Fc. A 25 pl PCR reaction was carried out with 25 pmol of each primer using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) 119 according to the manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 940C 2 minutes; 30 cycles of (940C 30 seconds, 584C 30 seconds, 724C 45 seconds), 720C 10 minutes. The expected sized band (-696 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA), and cloned into pGEM T Easy (Promega, Madison, WI) to produce an intermediate plasmid pSYN-Fc-001 (pGEM T-Easy/Fc). [0291] The mouse IgK signal sequence was added to the Fc CDS using the following primers: rc-IgK Sig seq-F: 5'-TTTAAGCTTGCCGCCACCATGGAGACAGACACACTCC TGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACAAAACT CACACATGCCCACCG -3' (SEQ ID NO: 100) Fc-noXma-GS-R: 5'- GGTCAGCTCATCGCGGGATGGG -3' (SEQ ID NO: 101) Fc-noXma-GS-F: 5'- CCCATCCCGCGATGAGCTGACC -3' (SEQ ID NO: 102) [0292] The rc-IgK signal sequence-F primer adds a HiridIll restriction site to the 5'end of the molecule, followed by a Kozak sequence (GCCGCCACC) (SEQ ID NO: 103) followed by the signal sequence from the mouse IgK light chain, directly abutted to the beginning of the Fc sequence (EU# 221). The Fc-noXma-GS-F and R primers remove the internal Xmal site from the Fc coding sequence, using the degeneracy of the genetic code to preserve the correct amino acid sequence. Two 25 pl PCR reactions were carried out with 25 pmol of either rc-IgK signal sequence-F and Fc-noXma-GS-R or Fc-noXma-GS-F and rcFc-R using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's 120 standard protocol in a MJ Thermocycler. The first reaction was carried out with 500 ng of leukocyte cDNA library (BD Biosciences Clontech, Palo Alto, CA) as a template using the following cycles: 940C 2 minutes; 30 cycles of (94 0 C 30 seconds, 550C 30 seconds, 720C 45 seconds), 720C 10 minutes. The second reaction was carried out with 500 ng of pSYN-Fc-001 as a template (above) using the following cycles: 94*C 2 minutes; 16 cycles of (944C 30 seconds, 580C 30 seconds, 720C 45 seconds), 720C 10 minutes. The expected sized bands (-495 and 299 bp, respectively) were gel purified with a Gel Extraction kit (Qiagen, Valencia CA), then combined in a PCR reaction with 25 pmol of rc-IgK signal sequence-F and rcFc-R primers and run as before, annealing at 58*C and continuing for 16 cycles. The expected sized band (-772 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA) and cloned into pGEM T-Easy (Promega, Madison, WI) to produce an intermediate plasmid pSYN-Fc-007 (pGEM T-Easy/lgK sig seq-Fc). The entire IgK signal sequence-Fc cassette was then subcloned using the Hindill and EcoRI sites into either the pEE6.4 (Lonza, Slough, UK) or pcDNA3.1 (Invitrogen, Carlsbad, CA) mammalian expression vector, depending on the system to be used, to generate pSYN-Fc-009 (pEE6.4/gK Sig seq-Fc) and pSYN-Fc-015 (pcDNA3/gK Sig seq-Fc). Example 32: Cloning of lqK signal sequence - Fc N297A construct for making untagged Fc N297A alone. [02931 In order to mutate Asn 297 (EU numbering) of the Fc to an Ala residue, the following primers were used: N297A-F 5'- GAGCAGTACGCTAGCACGTACCG -3' (SEQ ID NO: 104) N297A-R 5'- GGTACGTGCTAGCGTACTGCTCC -3' (SEQ ID NO: 105) 121 [0294] Two PCR reactions were carried out with 25 pmol of either rc-lgK signal sequence-F and N297A-R or N297A-F and rcFc-R using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard protocol in a MJ Thermocycler. Both reactions were carried out using 500 ng of pSYN-Fc-007 as a template using the following cycles: 94 0 C 2 minutes; 16 cycles of (940C 30 seconds, 48*C 30 seconds, 72*C 45 seconds), 72*C 10 minutes. The expected sized bands (-319 and 475 bp, respectively) were gel purified with a Gel Extraction kit (Qiagen, Valencia CA), then combined in a PCR reaction with 25 pmol of rc-IgK signal sequence-F and rcFc-R primers and run as before, annealing at 580C and continuing for 16 cycles. The expected sized band (-772 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA) and cloned into pGEM T Easy (Promega, Madison, WI) to produce an intermediate plasmid pSYN-Fc-008 (pGEM T-Easy/IgK Sig seq-Fc N297A). The entire IgK signal sequence-Fc alone cassette was then subcloned using the Hindill and EcoRI sites into either the pEE6.4 (Lonza, Slough, UK) or pcDNA3.1 (Invitrogen, Carlsbad, CA) mammalian expression vector, depending on the system to be used, to generate pSYN-Fc-01 0 (pEE6.4/gK Sig seq-Fc N297A) and pSYN-Fc-016 (pcDNA3/IgK Sig seq-Fc N297A). [0295] These same N297A primers were also used with rcFc-F and rcFc-R primers and pSYN-Fc-001 as a template in a PCR reaction followed by subcloning as indicated above to generate pSYN-Fc-002 (pGEM T Easy/Fc N297A). Example 33:Cloning of EpoFc and Fc into single plasmid for double gene vectors for making EpoFc wildtype or N297A monomer-dimer hybrids, and expression. [02961 An alternative to transfecting the EpoFc and Fc constructs on separate plasmids is to clone them into a single plasmid, also called a double gene vector, 122 such as used in the Lonza Biologics (Slough, UK) system. The Rsrll/EcoRI fragment from pSYN-Fc-002 was subcloned into the corresponding sites in pEE12.4 (Lonza Biologics, Slough, UK) according to standard procedures to generate pSYN Fc-006 (pEE12.4/Fc N297A fragment). The pSYN-EPO-004 plasmid was used as a template for a PCR reaction using Epo-F primer from Example 25 and the following primer: EpoRsr-R: 5'- CTGACGGTCCGCCCAGGAGTTCCG GAGCTGGGCACGGTGGGCATG TGTGAGTTTTGTCGACCGCAGCGG -3' (SEQ ID NO: 106) [02971 A PCR reaction was carried out using Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard protocol in a MJ Thermocycler as indicated above, for 16 cycles with 55 0 C annealing temperature. The expected sized band (-689 bp) was gel purified with a Gel Extraction kit (Qiagen, Valencia CA) and cloned into pSYN-Fc-006 using the Hindlll/RsrIl restriction sites, to generate pSYN-EPO-005 (pEE12.4/EpoFc N297A). The double gene vector for the EpoFc N297A monomer-dimer hybrid was then constructed by cloning the Notl/BamHl fragment from pSYN-Fc-010 into the corresponding sites in pSYN-EPO-005 to generate pSYN-EPO-008 (pEE12.4 6.4/EpoFc N297A/Fc N297A). [02981 The wild type construct was also made by subcloning the wild type Fc sequence from pSYN-Fc-001 into pSYN-EPO-005 using the Rsrll and EcoRI sites, to generate pSYN-EPO-006 (pEE12.4/EpoFc). The double gene vector for the EpoFc monomer-dimer hybrid was then constructed by cloning the Notl/BamHl 123 fragment from pSYN-Fc-009 into the corresponding sites in pSYN-EPO-006 to generate pSYN-EPO-007 (pEE12.4-6.4/EpoFc /Fc). [0299] Each plasmid was transfected into CHOK1SV cells and positive clones identified and adpated to serum-free suspension, as indicated in the Lonza Biologics Manual for Standard Operating procedures (Lonza Biologics, Slough, UK), and purified as indicated for the other monomer-dimer constructs. Example 34: Cloning of human IFNpFc, IFNp-Fc N297A with eight amino acid linkers and lgK-Fc-6His constructs (6xHis tag disclosed as SEQ ID NO: 107) [0300] 10 ng of a human genomic DNA library from Clontech (BD Biosciences Clontech, Palo Alto, CA) was used as a template to isolate human IFNp with its native signal sequence using the following primers: IFNp-F H3/SbfI: 5'- CTAGCCTGCAGGAAGCTTGCCGCCACCATGACCA ACAAGTGTCTCCTC -3' (SEQ ID NO: 92) IFNp-R (EFAG) Sal: 5'TTTGTCGACCGCAGCGGCGCCGGCGAACTCGTTTCGG AGGTAACCTGTAAG -3' (SEQ ID NO: 93) [0301] The reverse primer was also used to create an eight amino acid linker sequence (EFAGAAAV) (SEQ ID NO: 31) on the 3' end of the human IFNs sequence. The PCR reaction was carried out using the Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard protocol in a Rapid Cycler thermocycler (Idaho Technology, Salt Lake City, UT). A PCR product of the correct size (-607 bp) was gel purified using a Gel Extraction kit (Qiagen; Valencia, CA), cloned into TA cloning vector (Promega, Madison, WI) and sequenced. This construct was named pSYN-IFNp-002. pSYN 124 IFNP-002 was digested with Sbfl and Sall and cloned into pSP72 (Promega) at Pstl and Sall sites to give pSYN-IFN$-005. [03021 Purified pSYN-Fc-001 (0.6 pg) was digested with Sall and EcoRi and cloned into the corresponding sites of pSYN-IFN -005 to create the plasmid pSYN IFNp-006 which contains human IFNs linked to human Fc through an eight amino acid linker sequence. pSYN-IFNp-006 was then digested with Sbfl and EcoRI and the full-length IFNp-Fc sequence cloned into the Pstl and EcoRI sites of pEDdC.sig to create plasmid pSYN-IFNp-008. [0303] pSYN-Fc-002 containing the human Fc DNA with a single amino acid change from asparagine to alanine at position 297 (N297A; EU numbering) was digested with BspEl and Xmal to isolate a DNA fragment of -365 bp containing the N297A mutation. This DNA fragment was cloned into the corresponding sites in pSYN-IFNP-008 to create plasmid pSYN-lFNP-009 that contains the IFNp-Fc sequence with an eight amino acid linker and an N297A mutation in Fc in the expression vector, pED.dC. [0304] Cloning of IgK signal sequence-Fc N297A - 6His (SEQ ID NO: 107). The following primers were used to add a 6xHis tag (SEQ ID NO: 107) to the C terminus of the Fc N297A coding sequence: Fc GS-F: 5'- GGCAAGCTTGCCGCCACCATGGAGACAGACACACTCC -3' (SEQ ID NO: 94) Fc.6His-R: 5'- TCAGTGGTGATGGTGATGATGTTTACCCGGAGACAGGGAG -3' (SEQ ID NO: 95) 125 Fc.6His-F (6xHis tag disclosed as SEQ ID NO: 107): 5' GGTAAACATCATCACCATCACCACTGAGAATTCC AATATCACTAGTGAATTCG 3' (SEQ ID NO: 96) Sp6+T-R: 5'- GCTATTTAGGTGACACTATAGAATACTCAAGC -3' (SEQ ID NO: 97) [0305] Two PCR reactions were carried out with 50 pmol of either Fc GS-F and Fc.6His-R (6xHis tag disclosed as SEQ ID NO: 107) or Fc.6His-F (6xHis tag disclosed as SEQ ID NO: 107) and Sp6+T-R using the Expand High Fidelity System (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's standard protocol in a MJ Thermocycler. Both reactions were carried out using 500 ng of pSYN-Fc-008 as a template in a 50 pl reaction, using standard cycling conditions. The expected sized bands (-780 and 138 bp, respectively) were gel purified with a Gel Extraction kit (Qiagen, Valencia CA), then combined in a 50 pl PCR reaction with 50 pmol of Fc GS-F and Sp6+T-R primers and run as before, using standard cycling conditions. The expected sized band (-891 bp) was gel purified with a Gel Extraction kit.(Qiagen, Valencia CA) and cloned into pcDNA6 V5-His B using the Hindill and EcoRI sites to generate pSYN-Fc-014 (pcDNA6/IgK Sig seq-Fc N297A-6 His). Example 35: Expression and purification of IFNpFc, IFNp-Fc N297A homodimer and IFNp-Fc N297A monomer-dimer hybrid [03061 CHO DG44 cells were plated in 100 mm tissue culture dishes and grown to a confluency of 50%-60%. A total of 10 pg of DNA was used to transfect a single 100 mm dish. For the homodimer transfection, 10 pg of the pSYN-FNP-008 or pSYN-lFNP-009 construct was used; for the monomer-dimer hybrid transfection, 8 pg of the pSYN-lFNP-009 + 2 pg of pSYN-Fc-014 construct was used. The cells 126 were transfected using Superfect transfection reagents (Qiagen, Valencia, CA) according to the manufacturer's instructions. 48 to 72 hours post-transfection, growth medium was removed and cells were released from the plates with 0.25% trypsin and transferred to T75 tissue culture flasks in selection medium (MEM Alpha without nucleosides plus 5% dialyzed fetal bovine serum). The selection medium for the monomer-dimer hybrid transfection was supplemented with 5 pg/ml Blasticidin (Invitrogen, Carlsbad, CA). Selection was continued for 10-14 days until the cells began to grow well and stable cell lines were established. Protein expression was subsequently amplified by the addition methotrexate: ranging from 10 to 50 nM. [0307] For all cell lines, approximately 2 x 107 cells were used to inoculate 300 ml of growth medium in a 1700 cm 2 roller bottle (Corning, Corning, NY). The roller bottles were incubated in a 5% CO 2 incubator at 37 0 C for approximately 72 hours. The growth medium was then exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 pg/ml human insulin.). The production medium (conditioned medium) was collected every day for 10 days and stored at 4 0 C. Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the medium was clarified using a SuporCap-1 00 (0.8/0.2 pm) filter from Pall Gelman Sciences (Ann Arbor, MI). All of the following steps were performed at 4 0 C. The clarified medium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCl), eluted with 0.1 M glycine, pH 2.7, and then neutralized with 1/10 volume of 1 M Tris-HCI pH 8.0, 5 M NaCl. The homodimer proteins were further purified over a Superdex 200 Prep Grade 127 sizing column run and eluted in 50 mM sodium phosphate pH 7.5, 500 mM NaCl, 10% glycerol. [0308] The monomer-dimer hybrid protein was subject to further purification since it contained a mixture of IFNpFc N297A:lFNpFc N297A homodimer, IFNPFc N297A: Fc N297A His monomer-dimer hybrid, and Fc N297A His: Fc N297A His homodimer. Material was applied to a Nickel chelating column in 50 mM sodium phosphate pH 7.5, 500 mM NaCl. After loading, the column was washed with 50 mM imidazole in 50 mM sodium phosphate pH 7.5, 500 mM NaCl and protein was eluted with a gradient of 50 - 500 mM imidazole in 50 mM sodium phosphate pH 7.5, 500 mM NaCl. Fractions corresponding to elution peaks on a UV detector were collected and analyzed by SDS-PAGE. Fractions from the first peak contained IFNpFc N297A: Fc N297A His monomer-dimer hybrid, while the second peak contained Fc N297A His: Fc N297A His homodimer. All fractions containing the monomer-dimer hybrid, but no Fc homodimer, were pooled and applied directly to a Superdex 200 Prep Grade sizing column, run and eluted in 50 mM sodium phosphate pH 7.5, 500 mM NaCl, 10% glycerol. Fractions containing IFNp-Fc N297A:Fc N297A His monomer-dimer hybrids were pooled and stored at -80 0 C. Example 36: Antiviral assay for IFNO activity [0309] Antiviral activity (IU/ml) of IFNs fusion proteins was determined using a CPE (cytopathic effect) assay. A549 cells were plated in a 96 well tissue culture plate in growth media (RPMI 1640 supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine) for 2 hours at 370C, 5% C02. IFN standards and IFN@ fusion proteins were diluted in growth media and added to cells in triplicate for 20 128 hours at 370C, 5% C02. Following incubation, all media was removed from wells, encephalomyocarditis virus (EMCV) was diluted in growth media and added (3000 pfu/well) to each well with the exception of control wells. Plates were incubated at 370C, 5% C02 for 28 hours. Living cells were fixed with 10% cold trichloroacetic acid (TCA) and then stained with Sulforhodamine B (SRB) according to published protocols (Rubinstein et al. 1990, J. Natl. Cancer Inst. 82, 1113). The SRB dye was solubilized with 10 mM Tris pH 10.5 and read on a spectrophotometer at 490 nm. Samples were analyzed by comparing activities to a known standard curve ranging from 10 to 0.199 IU/ml. The results are presented below in Table 8 and demonstrate increased antiviral activity of monomer-dimer hybrids. TABLE 8: INTERFERON BETA ANTIVIRAL ASSAY HOMODIMER V. MONOMER-DIMER HYBRID Protein Antiviral Std dev Activity (IU/nmol) IFNp-Fc 8aa linker homodimer 4.5 x 10" 0.72 x 105 IFNPFc N297A 8aa linker homodimer 3.21 x 10 0.48 x 10 IFNPFc N297A 8aa linker: Fc His 12.2 x 10 2 x 10t monomer-dimer hybrid Example 37: Administration of IFNpFc Homodimer and Monomer-Dimer Hybrid With an Eight Amino Acid Linker to CynomolIus Monkeys [0310] For pulmonary administration, aerosols of either IFNOFc homodimer or IFNPFc N297A monomer-dimer hybrid proteins (both with the 8 amino acid linker) in PBS, pH 7.4, 0.25% HSA were created with the Aeroneb ProTm (AeroGen, Mountain View, CA) nebulizer, in-line with a Bird Mark 7A respirator, and administered to anesthetized naYve cynomolgus monkeys through endotracheal tubes 129 (approximating normal tidal breathing). Blood samples were taken at various time points, and the amount of IFNp-containing protein in the resulting serum was quantitated using a human IFNs Immunoassay (Biosource International, Camarillo, CA). Pharmacokinetic parameters were calculated using the software WinNonLin. Table 9 presents the results of cynomolgus monkeys treated with IFNpFc N297A monomer-dimer hybrid or IFNPFc homodimer. 130 TABLE 9: ADMINISTRATION OF IFNpFC N297A MONOMER-DIMER HYBRID AND IFNgFC HOMODIMER TO MONKEYS Approx. AUC Monkey Deposited Cma (hr*ng/ml) t 1 1 2 t1/ 2 avg Protemn Dose' (ng/ml) (hr) (hr) (pg/kg)______ ___ IFNpFc C07308 pulm 20 23.3 987.9 27.6 N297A C07336 pulm 20 22.4 970.6 25.6 27.1 monomer- pulm 20 1002.7 dimer hybrid C07312 21.2 28.0 IFNDFc 007326 pulm 20 2.6 94.6 11.1 homodimer C07338, pulm 20 5.0 150.6 11.7 __. 1 Based on 15% deposition fraction of nebulized dose as determined by gamma scintigraphy [0311] The pharmacokinetics of IFNPFc with an 8 amino acid linker administered to cynomolgus monkeys is presented in figure 15. The figure compares the IFNPFc homodimer with the IFNPFc N297A monomer-dimer hybrid in monkeys after administration of a single pulmonary dose. Significantly higher serum levels were obtained in monkeys treated with the monomer-dimer hybrid compared to the homodimer. [03121 Serum samples were also analyzed for neopterin levels (a biomarker of IFNp activity) using a neopterin immunoassay (MP Biomedicals, Orangeburg, NY).. The results for this analysis are shown in figure 16. The figure compares neopterin stimulation in response to the IFNP-Fc homodimer and the iFNP-Fc N297A monomer-dimer hybrid. It can be seen that significantly higher neopterin levels were detected in monkeys treated with IFNB-Fc N297A monomer-dimer hybrid as compared to the IFN@-Fc homodimer. [0313 All numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being 131 modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches. [0314] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supercede and/or take precedence over any such contradictory material. [0315] Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The specific embodiments described herein are offered by way of example only and are not meant to be limiting in any way. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. 132
权利要求:
Claims (38)
[1] 1. A monomer-dimer hybrid immunoconjugate comprising a first polypeptide chain and a second polypeptide chain, wherein said first chain comprises (i) a clotting factor and (ii) an immunoglobulin constant region or a portion thereof comprising a neonatal Fc Receptor binding site, and said second chain comprises an immunoglobulin constant region or a portion thereof comprising a neonatal Fc Receptor binding site and does not comprise a biologically active molecule or an immunoglobulin variable domain, and wherein said first chain and said second chain are linked.
[2] 2. The immunoconjugate of claim 1, wherein said second chain consists of the immunoglobulin constant region or a portion thereof.
[3] 3. The immunoconjugate of claim 1, wherein said immunoglobulin constant region or a portion thereof in said first chain is an Fc fragment.
[4] 4. The immunoconjugate of claim 3, wherein said immunoglobulin constant region or a portion thereof in said second chain is an Fc fragment.
[5] 5. The immunoconjugate of claim 1, wherein said immunoglobulin constant region or a portion thereof in said first chain and said immunoglobulin constant region or a portion thereof in said second chain are identical.
[6] 6. The immunoconjugate of claim 1, wherein the clotting factor has a clotting activity.
[7] 7. The immunoconjugate of claim 6, wherein the clotting factor activates one or more member of a coagulation cascade.
[8] 8. The immunoconjugate of claim 1, wherein said immunoconjugate treats a bleeding disorder when administered to a subject in need thereof.
[9] 9. The immunoconjugate of claim 8, wherein the bleeding disorder is hemophilia A or hemophilia B. 133
[10] 10. The immunoconjugate of claim 8, wherein the bleeding disorder is an acute bleeding episode resulting from severe trauma.
[11] 11. The immunoconjugate of claim 8, wherein said treatment is prophylactic.
[12] 12. The immunoconjugate of claim 1, wherein the clotting factor and the immunoglobulin constant region or a portion thereof are connected by a linker.
[13] 13. The immunoconjugate of claim 12, wherein said linker is selected from the group consisting of: a. G.sub.n; b. (GA).sub.n; c. (GGS).sub.n; d. SEQ ID NO: 31; e. SEQ ID NO: 34; e. SEQ ID NO: 35; f. SEQ ID NO: 36; g. SEQ ID NO: 37; h. SEQ ID NO: 38; i. SEQ ID NO: 39; j. SEQ ID NO: 40; k. SEQ ID NO: 85; and I. SEQ ID NO: 86; where n is any integer between 1 and 10.
[14] 14. The immunoconjugate of claim 1, wherein said clotting factor comprises one or more of Factor V, Factor VII, Factor VIIa, Factor VIlI, Factor VIlla, Factor IX, Factor IXa, Factor X, Factor Xa, Factor XI, Factor XII, Factor XIII, fibrinogen, prothrombin, von Willebrand factor, and a combination thereof.
[15] 15. The immunoconjugate of claim 4, wherein said clotting factor is Factor VII or Factor VIla.
[16] 16. The immunoconjugate of claim 4, wherein said clotting factor is Factor Vill or Factor Villa.
[17] 17. The immunoconjugate of claim 4, wherein said clotting factor is Factor IX or Factor IXa.
[18] 18. The immunoconjugate of claim 1, wherein said first chain and said second chain are linked either covalently or non-covalently.
[19] 19. The immunoconjugate of claim 18, wherein said first chain and said second chain are linked via a disulfide bond. 134
[20] 20. The immunoconjugate of claim 1, wherein said clotting factor is a chimeric clotting factor, which has a clotting activity.
[21] 21. The immunoconjugate of claim 1, wherein said immunoconjugate has higher maximum serum concentration (Cmax), when administered orally, compared to a homodimer comprising two polypeptide chains, each of which is identical to said first chain of the immunoconjugate.
[22] 22. A monomer-dimer hybrid immunoconjugate comprising a first polypeptide chain and a second polypeptide chain, wherein said first chain comprises (i) Factor VIII or Factor Vllla and (ii) an immunoglobulin constant region or a portion thereof comprising a neonatal Fc Receptor binding site, and said second chain comprises an immunoglobulin constant region or a portion thereof comprising a neonatal Fc Receptor binding site and does not comprise a biologically active molecule or an immunoglobulin variable domain, and wherein said first chain and said second chain are linked.
[23] 23. The immunoconjugate of claim 22, wherein said second chain consists of the immunoglobulin constant region or a portion thereof.
[24] 24. A monomer-dimer hybrid immunoconjugate comprising a first polypeptide chain and a second polypeptide chain, wherein said first chain comprises (i) Factor IX or Factor IXa and (ii) an immunoglobulin constant region or a portion thereof comprising a neonatal Fc Receptor binding site, and said second chain comprises an immunoglobulin constant region or a portion thereof comprising a neonatal Fc Receptor binding site, and does not comprise a biologically active molecule or an immunoglobulin variable domain, and wherein said first chain and said second chain are linked.
[25] 25. The immunoconjugate of claim 24, wherein said second chain consists of the immunoglobulin constant region or a portion thereof.
[26] 26. A pharmaceutical composition comprising the immunoconjugate of claim 1 and a pharmaceutically acceptable carrier. 135
[27] 27. The composition of claim 26, which is formulated for oral administration, buccal administration, sublingual administration, intravenous injection, subcutaneous injection, intramuscular injection, nasal administration, rectal administration vaginal administration, pulmonary administration, or inhalation.
[28] 28. The composition of claim 27, further comprising at least one agent, which is capable of treating a disease or condition.
[29] 29. The composition of claim 28, wherein said at least one agent is a protein comprising a clotting factor.
[30] 30. The composition of claim 29, wherein said clotting factor is selected from the group consisting of Factor V, Factor VII, Factor VIla, Factor VIII, Factor VIlla, Factor IX, Factor IXa, Factor X, Factor Xa, Factor XI, Factor XII, Factor XIII, fibrinogen, prothrombin, von Willebrand factor, and a combination thereof.
[31] 31. The composition of claim 30, wherein said at least one agent is a monomer-dimer hybrid immunoconjugate.
[32] 32. The composition of claim 30, wherein said at least one agent is a dimer.
[33] 33. The immunoconjugate of claim 1, wherein the second chain consists essentially of an Fc fragment.
[34] 34. The immunoconjugate of claim 33, wherein the first chain consists essentially of (i) a clotting factor and (ii) an Fc fragment.
[35] 35. The immunoconjugate of claim 34, wherein the clotting factor is FVII, FVIIa, FVIII, FVIIIa, FIX, or FIXa.
[36] 36. The immunoconjugate of claim 2, wherein the first chain consists of (i) a clotting factor and (ii) an Fc fragment. 136
[37] 37. The immunoconjugate of claim 36, wherein the clotting factor is FVIII or FVilla.
[38] 38. The immunoconjugate of claim 36, wherein the clotting factor is FIX or FIXa. Date: 12 April 2013 137
类似技术:
公开号 | 公开日 | 专利标题
US11168125B2|2021-11-09|Immunoglobulin chimeric monomer-dimer hybrids
US7348004B2|2008-03-25|Immunoglobulin chimeric monomer-dimer hybrids
AU2012200470B2|2014-12-18|Immunoglobulin Chimeric Monomer-Dimer Hybrids
AU2016244273A1|2016-11-03|Immunoglobulin Chimeric Monomer-Dimer Hybrids
AU2013245463A1|2013-10-31|Immunoglobulin Chimeric Monomer-Dimer Hybrids
同族专利:
公开号 | 公开日
AU2012200470B2|2014-12-18|
AU2012200470A1|2012-02-16|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题
法律状态:
2013-12-05| FGA| Letters patent sealed or granted (standard patent)|
2014-11-20| NDA| Extension of term for standard patent accepted (sect.70)|Free format text: PRODUCT NAME: ALPROLIX EFTRENONACOG ALFA Filing date: 20140501 |
2015-03-26| NDB| Extension of term for standard patent granted (sect.76)|Free format text: PRODUCT NAME: ALPROLIX EFTRENONACOG ALFA Filing date: 20140501 Extension date: 20290501 |
2018-02-15| HB| Alteration of name in register|Owner name: BIOVERATIV THERAPEUTICS INC. Free format text: FORMER NAME(S): BIOGEN HEMOPHILIA INC. |
优先权:
申请号 | 申请日 | 专利标题
US60/469,600||2003-05-06||
US60/487,964||2003-07-17||
US60/539,207||2004-01-26||
AU2012200470A|AU2012200470B2|2003-05-06|2012-01-27|Immunoglobulin Chimeric Monomer-Dimer Hybrids|
AU2013204787A|AU2013204787B2|2003-05-06|2013-04-12|Immunoglobulin Chimeric Monomer-Dimer Hybrids|AU2013204787A| AU2013204787B2|2003-05-06|2013-04-12|Immunoglobulin Chimeric Monomer-Dimer Hybrids|
AU2013245463A| AU2013245463B2|2003-05-06|2013-10-15|Immunoglobulin Chimeric Monomer-Dimer Hybrids|
AU2016244273A| AU2016244273B2|2003-05-06|2016-10-13|Immunoglobulin Chimeric Monomer-Dimer Hybrids|
AU2019200306A| AU2019200306B2|2003-05-06|2019-01-16|Immunoglobulin chimeric monomer-dimer hybrids|
[返回顶部]